Strain Name:
C57BL/6J-MtgxR9220Btlr/Mmmh
Stock Number:
069056-MU
Citation ID:
RRID:MMRRC_069056-MU
Other Names:
R9220 (G1)
Major Collection:

Strain Information

Dicer1
Name: dicer 1, ribonuclease type III
Synonyms: 1110006F08Rik, D12Ertd7e, Dicer1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 192119
VEGA: 12
Homologene: 13251
Sncg
Name: synuclein, gamma
Synonyms: persyn, C79089
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 20618
Homologene: 2322
Ank2
Name: ankyrin 2, brain
Synonyms: ankyrin B, Ank-2, Ankyrin-2, Ankyrin-B, Gm4392
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109676
HGNC: HGNC:493
Ndrg1
Name: N-myc downstream regulated gene 1
Synonyms: Tdd5, PROXY1, CMT4D, CAP43, TDD5, DRG1, Ndr1, Ndrl
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 17988
HGNC: HGNC:7679
Homologene: 55953
Bcl2l13
Name: BCL2 like 13
Synonyms: BCL-RAMBO, Mil1, E430016C20Rik, Mil-1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 94044
Homologene: 9111
Rpap1
Name: RNA polymerase II associated protein 1
Synonyms: 1190005L06Rik, A730023M06Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68925
Homologene: 32269
Ddx27
Name: DEAD box helicase 27
Synonyms: DEAD (Asp-Glu-Ala-Asp) box polypeptide 27
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228889
Homologene: 6431
Helz
Name: helicase with zinc finger domain
Synonyms: 9630002H22Rik, 9430093I07Rik, 3110078M01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 78455
Homologene: 8918
Bltp3b
Name: bridge-like lipid transfer protein family member 3B
Synonyms: 4930506D01Rik, 2010319N22Rik, E030041M21Rik, Uhrf1bp1l
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 75089
VEGA: 10
Homologene: 12590
Afg3l2
Name: AFG3-like AAA ATPase 2
Synonyms: 2310036I02Rik, par, Emv66
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 69597
VEGA: 18
HGNC: HGNC:315
Homologene: 4947
Tnfrsf21
Name: tumor necrosis factor receptor superfamily, member 21
Synonyms: DR6, Death receptor 6, TR7
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 94185
VEGA: 17
Homologene: 8696
Minar1
Name: membrane integral NOTCH2 associated receptor 1
Synonyms: DD1, AF529169
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 209743
Homologene: 17782
Vps13d
Name: vacuolar protein sorting 13D
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230895
Homologene: 15583
Plekhg1
Name: pleckstrin homology domain containing, family G (with RhoGef domain) member 1
Synonyms: D10Ertd733e
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 213783
Homologene: 18897
Fam3b
Name: FAM3 metabolism regulating signaling molecule B
Synonyms: D16Jhu19e, 9030624C24Rik, ORF9, Pander
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 52793
HGNC: HGNC:1253
Homologene: 10766
Septin9
Name: septin 9
Synonyms: SL3-3 integration site 1, Sint1, Msf, MSF1, PNUTL4, Sept9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 53860
HGNC: HGNC:7323
Homologene: 90949
Zfp266
Name: zinc finger protein 266
Synonyms: 5330440G10Rik, 5730601F06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 77519
Homologene: 105676
Clp1
Name: CLP1, cleavage and polyadenylation factor I subunit
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 98985
Homologene: 4975
Wscd1
Name: WSC domain containing 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216881
Homologene: 18590
Akap6
Name: A kinase anchor protein 6
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238161
VEGA: 12
HGNC: HGNC:376
Homologene: 3157
Dnah10
Name: dynein, axonemal, heavy chain 10
Synonyms: Dnahc10
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56087
HGNC: HGNC:2941
Homologene: 25816
Nlrp4a
Name: NLR family, pyrin domain containing 4A
Synonyms: Nalp-eta, E330028A19Rik, Nalp4a
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243880
Homologene: 79696
Gpn1
Name: GPN-loop GTPase 1
Synonyms: 2410004J02Rik, Xab1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 74254
Homologene: 5257
Atp1a3
Name: ATPase, Na+/K+ transporting, alpha 3 polypeptide
Synonyms: Atpa-2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232975
HGNC: HGNC:801
Homologene: 113729
Fsd1l
Name: fibronectin type III and SPRY domain containing 1-like
Synonyms: A230072O16Rik, Csdufd1, Ccdc10, Fsd1nl
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 319636
Homologene: 45825
Unc80
Name: unc-80, NALCN activator
Synonyms: C230061B10Rik, C030018G13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329178
Homologene: 122243
Eml1
Name: echinoderm microtubule associated protein like 1
Synonyms: ELP79, 1110008N23Rik, A930030P13Rik, heco
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 68519
HGNC: HGNC:3330
Homologene: 20931
Phf8l
Name: PHD finger protein 8 like
Synonyms: 4921501E09Rik, Phf8-ps
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74042
VEGA: 17
Homologene: 66275
Mcemp1
Name: mast cell expressed membrane protein 1
Synonyms: 1810033B17Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 69189
Homologene: 52162
Matn2
Name: matrilin 2
Synonyms: Crtm2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 17181
VEGA: 15
HGNC: HGNC:6908
Homologene: 20538
Shpk
Name: sedoheptulokinase
Synonyms: 4930431K22Rik, Carkl
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74637
HGNC: HGNC:1492
Homologene: 8319
Acte1
Name: actin, epsilon 1
Synonyms: LOC244239, Gm498
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 102636989
Homologene: 131918
Grid2
Name: glutamate receptor, ionotropic, delta 2
Synonyms: GluRdelta2, tpr, B230104L07Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14804
HGNC: HGNC:4576
Homologene: 74399
Galc
Name: galactosylceramidase
Synonyms: Gacy, 2310068B06Rik, galactocerebrosidase, A930008M05Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 14420
VEGA: 12
HGNC: HGNC:4115
Homologene: 124
Plekhg3
Name: pleckstrin homology domain containing, family G (with RhoGef domain) member 3
Synonyms: MGC40768
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 263406
VEGA: 12
Homologene: 77478
Nox4
Name: NADPH oxidase 4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 50490
HGNC: HGNC:7891
Homologene: 41065
Wdr35
Name: WD repeat domain 35
Synonyms: 4930459M12Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 74682
Homologene: 10814
Plekhd1
Name: pleckstrin homology domain containing, family D (with coiled-coil domains) member 1
Synonyms: 3830431G21Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217682
Homologene: 15090
Zfp62
Name: zinc finger protein 62
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22720
Homologene: 40686
Rragd
Name: Ras-related GTP binding D
Synonyms: 5730543C08Rik, D4Ertd174e, C030003H22Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 52187
Homologene: 49667
Slc22a2
Name: solute carrier family 22 (organic cation transporter), member 2
Synonyms: Oct2, Orct2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20518
VEGA: 17
Homologene: 68293
Or8b52
Name: olfactory receptor family 8 subfamily B member 52
Synonyms: GA_x6K02T2PVTD-32368166-32367237, MOR168-2P, Olfr917
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258183
VEGA: 9
B4galt2
Name: UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 53418
HGNC: HGNC:925
Homologene: 2804
Or7g21
Name: olfactory receptor family 7 subfamily G member 21
Synonyms: GA_x6K02T2PVTD-12857805-12858749, MOR152-3, Olfr836
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258557
HGNC: HGNC:8466
Homologene: 115507
Fabp6
Name: fatty acid binding protein 6
Synonyms: I-15P, I-BABP, ILBP3, Illbp, gastrotropin
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16204
HGNC: HGNC:3561
Homologene: 1108
Slirp
Name: SRA stem-loop interacting RNA binding protein
Synonyms: 1810035L17Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 380773
Homologene: 12825
Vmn1r149
Name: vomeronasal 1 receptor 149
Synonyms: Gm4194
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100043051
Homologene: 104166
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to G, chromosome 1 at 66,507,375 bp (GRCm38)
  • A to T, chromosome 2 at 84,723,732 bp (GRCm38)
  • T to C, chromosome 2 at 119,774,188 bp (GRCm38)
  • T to C, chromosome 2 at 167,029,513 bp (GRCm38)
  • T to C, chromosome 3 at 126,943,437 bp (GRCm38)
  • A to G, chromosome 4 at 32,995,924 bp (GRCm38)
  • A to T, chromosome 4 at 53,679,799 bp (GRCm38)
  • T to C, chromosome 4 at 117,877,202 bp (GRCm38)
  • A to G, chromosome 4 at 145,056,488 bp (GRCm38)
  • G to A, chromosome 5 at 31,507,540 bp (GRCm38)
  • A to T, chromosome 5 at 124,794,373 bp (GRCm38)
  • A to T, chromosome 6 at 63,908,904 bp (GRCm38)
  • C to A, chromosome 6 at 120,870,774 bp (GRCm38)
  • A to T, chromosome 7 at 22,437,953 bp (GRCm38)
  • C to A, chromosome 7 at 24,997,200 bp (GRCm38)
  • A to T, chromosome 7 at 26,450,098 bp (GRCm38)
  • C to T, chromosome 7 at 87,321,566 bp (GRCm38)
  • G to T, chromosome 7 at 143,881,165 bp (GRCm38)
  • A to G, chromosome 8 at 3,667,512 bp (GRCm38)
  • T to C, chromosome 9 at 19,121,897 bp (GRCm38)
  • G to A, chromosome 9 at 20,502,041 bp (GRCm38)
  • A to T, chromosome 9 at 38,665,507 bp (GRCm38)
  • T to A, chromosome 9 at 89,602,345 bp (GRCm38)
  • T to C, chromosome 10 at 3,963,805 bp (GRCm38)
  • A to T, chromosome 10 at 89,790,595 bp (GRCm38)
  • C to T, chromosome 11 at 43,598,745 bp (GRCm38)
  • T to A, chromosome 11 at 49,215,248 bp (GRCm38)
  • A to G, chromosome 11 at 71,771,924 bp (GRCm38)
  • GACCTTAGCCAGAAGGAGCCTTAGTTCATCAA to GA, chromosome 11 at 73,223,170 bp (GRCm38)
  • T to A, chromosome 11 at 107,670,047 bp (GRCm38)
  • T to C, chromosome 11 at 117,351,570 bp (GRCm38)
  • T to A, chromosome 12 at 8,986,000 bp (GRCm38)
  • A to T, chromosome 12 at 53,140,449 bp (GRCm38)
  • T to A, chromosome 12 at 76,572,065 bp (GRCm38)
  • T to A, chromosome 12 at 80,721,952 bp (GRCm38)
  • G to A, chromosome 12 at 87,447,606 bp (GRCm38)
  • A to G, chromosome 12 at 98,254,264 bp (GRCm38)
  • A to G, chromosome 12 at 104,713,156 bp (GRCm38)
  • C to A, chromosome 12 at 108,514,443 bp (GRCm38)
  • T to C, chromosome 14 at 34,374,517 bp (GRCm38)
  • T to C, chromosome 15 at 34,410,179 bp (GRCm38)
  • A to G, chromosome 15 at 66,933,862 bp (GRCm38)
  • A to T, chromosome 16 at 97,500,911 bp (GRCm38)
  • T to A, chromosome 17 at 12,619,870 bp (GRCm38)
  • T to C, chromosome 17 at 33,067,520 bp (GRCm38)
  • A to G, chromosome 17 at 43,087,910 bp (GRCm38)
  • T to G, chromosome 18 at 67,429,196 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9220 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069056-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.