Strain Name:
C57BL/6J-MtgxR9243Btlr/Mmmh
Stock Number:
069069-MU
Citation ID:
RRID:MMRRC_069069-MU
Other Names:
R9243 (G1)
Major Collection:

Strain Information

Nrcam
Name: neuronal cell adhesion molecule
Synonyms: Bravo, C030017F07Rik, C130076O07Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319504
VEGA: 12
HGNC: HGNC:7994
Homologene: 21041
Myd88
Name: myeloid differentiation primary response gene 88
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17874
HGNC: HGNC:7562
Homologene: 1849
Cacna1g
Name: calcium channel, voltage-dependent, T type, alpha 1G subunit
Synonyms: a1G, Cav3.1d
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12291
HGNC: HGNC:1394
Homologene: 22544
Gad2
Name: glutamic acid decarboxylase 2
Synonyms: GAD65, Gad-2, 6330404F12Rik, GAD(65)
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14417
HGNC: HGNC:4093
Homologene: 20223
Prrc1
Name: proline-rich coiled-coil 1
Synonyms: 2310058D16Rik, 9430085A19Rik, 3110038B19Rik, 1190002C06Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 73137
VEGA: 18
Homologene: 12491
Igf1r
Name: insulin-like growth factor I receptor
Synonyms: CD221, IGF-1R, line 186, hyft, A330103N21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16001
HGNC: HGNC:5465
Homologene: 30997
Parp1
Name: poly (ADP-ribose) polymerase family, member 1
Synonyms: PARP, sPARP-1, Adprp, parp-1, 5830444G22Rik, Adprt1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11545
HGNC: HGNC:270
Homologene: 1222
Cep57
Name: centrosomal protein 57
Synonyms: 4931428M20Rik, 4921510P06Rik, Tsp57, 3110002L15Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74360
Homologene: 8790
Zfp462
Name: zinc finger protein 462
Synonyms: Gt4-2, 9430078C22Rik, Zfpip
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242466
Homologene: 41430
Hdac4
Name: histone deacetylase 4
Synonyms: 4932408F19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 208727
Homologene: 55946
Exoc2
Name: exocyst complex component 2
Synonyms: Sec5, 2410030I24Rik, Sec5l1, Gm29675
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 66482
Homologene: 10122
Slf1
Name: SMC5-SMC6 complex localization factor 1
Synonyms: C730024G01Rik, 2700017A04Rik, Brctx, Brctd1, Ankrd32
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105377
Homologene: 13000
Dock7
Name: dedicator of cytokinesis 7
Synonyms: 3110056M06Rik, LOC242555, m
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67299
Homologene: 23566
Zzz3
Name: zinc finger, ZZ domain containing 3
Synonyms: 3110065C23Rik, 6430567E01Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 108946
Homologene: 9182
Htt
Name: huntingtin
Synonyms: huntingtin, HD, htt, IT15, C430023I11Rik, Hdh
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 15194
HGNC: HGNC:4851
Homologene: 1593
Itgb1
Name: integrin beta 1 (fibronectin receptor beta)
Synonyms: CD29, beta1 integrin, 4633401G24Rik, Fnrb, Gm9863
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16412
HGNC: HGNC:6153
Homologene: 22999
Pex19
Name: peroxisomal biogenesis factor 19
Synonyms: Pxf, peroxisome biogenesis factor 19
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19298
HGNC: HGNC:9713
Homologene: 134253
Ube2f
Name: ubiquitin-conjugating enzyme E2F (putative)
Synonyms: 2510010F15Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 67921
Homologene: 12212
Csnk1g2
Name: casein kinase 1, gamma 2
Synonyms: 2810429I12Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103236
VEGA: 10
HGNC: HGNC:2455
Homologene: 100845
Appl1
Name: adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1
Synonyms: 7330406P05Rik, 2900057D21Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 72993
Homologene: 32143
Zfp236
Name: zinc finger protein 236
Synonyms: LOC240456
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 329002
Homologene: 7198
Rag2
Name: recombination activating gene 2
Synonyms: Rag-2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19374
HGNC: HGNC:9832
Homologene: 7507
Cep295
Name: centrosomal protein 295
Synonyms: LOC382128, 5830418K08Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 319675
Homologene: 27936
Skic2
Name: SKI2 subunit of superkiller complex
Synonyms: Ski2w, 4930534J06Rik, Skiv2l
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 108077
Homologene: 123971
Capg
Name: capping actin protein, gelsolin like
Synonyms: mbh1, gCap39
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12332
HGNC: HGNC:1474
Homologene: 37523
Cfap46
Name: cilia and flagella associated protein 46
Synonyms: 9330101J02Rik, Ttc40
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 212124
Akap6
Name: A kinase anchor protein 6
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238161
VEGA: 12
HGNC: HGNC:376
Homologene: 3157
Tmem125
Name: transmembrane protein 125
Synonyms: 6330530A05Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230678
Homologene: 16952
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: LOC380698, OTTMUSG00000005786
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380698
Homologene: 70869
Impg2
Name: interphotoreceptor matrix proteoglycan 2
Synonyms: PG10.2, IPM200, Spacrcan
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224224
Homologene: 9439
Cdh17
Name: cadherin 17
Synonyms: HPT-1, BILL-cadherin, LI-cadherin
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12557
HGNC: HGNC:1756
Homologene: 56859
Grik3
Name: glutamate receptor, ionotropic, kainate 3
Synonyms: Glur-7, Glur7
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14807
HGNC: HGNC:4581
Homologene: 73901
Or51ah3
Name: olfactory receptor family 51 subfamily AH member 3
Synonyms: GA_x6K02T2PBJ9-6284902-6285843, MOR19-2, Olfr615
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259084
Homologene: 17494
Klrd1
Name: killer cell lectin-like receptor, subfamily D, member 1
Synonyms: CD94
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16643
HGNC: HGNC:6378
Homologene: 1705
Myo1c
Name: myosin IC
Synonyms: myosin-Ibeta, myr2, C80397, mm1beta
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17913
HGNC: HGNC:7597
Homologene: 32046
Gria1
Name: glutamate receptor, ionotropic, AMPA1 (alpha 1)
Synonyms: GluR1, GluR-A, Glr-1, Glur-1, Glur1, GluRA, Glr1, 2900051M01Rik, HIPA1, GluA1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14799
HGNC: HGNC:4571
Homologene: 20226
Pappa2
Name: pappalysin 2
Synonyms: placenta-specific 3, pregnancy-associated plasma preproprotein-A2, pregnancy-associated plasma protein-E, PAPP-A2, PLAC3, Pappe
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 23850
Homologene: 10661
Nnt
Name: nicotinamide nucleotide transhydrogenase
Synonyms: 4930423F13Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18115
HGNC: HGNC:7863
Or8k40
Name: olfactory receptor family 8 subfamily K member 40
Synonyms: GA_x6K02T2Q125-48247345-48246404, MOR188-4, Olfr1090
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258844
Homologene: 17413
Krtap16-1
Name: keratin associated protein 16-1
Synonyms: AI450886
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 100504183
Homologene: 99988
Slc52a3
Name: solute carrier protein family 52, member 3
Synonyms: 2310046K01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69698
Homologene: 12324
Fktn
Name: fukutin
Synonyms: Fukutin, Fcmd
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 246179
HGNC: HGNC:3622
Homologene: 31402
Kcnh8
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: Kv12.1, ELK1, C130090D05Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 211468
Homologene: 14332
Idh1
Name: isocitrate dehydrogenase 1 (NADP+), soluble
Synonyms: Id-1, Idh-1, E030024J03Rik, IDPc
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 15926
HGNC: HGNC:5382
Homologene: 21195
Pcdhb17
Name: protocadherin beta 17
Synonyms: Pcdhb16, PcdhbQ
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93888
Homologene: 81881
Sgpp1
Name: sphingosine-1-phosphate phosphatase 1
Synonyms: mSPP1, SPP1, SPP
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 81535
VEGA: 12
Homologene: 101696
Msrb2
Name: methionine sulfoxide reductase B2
Synonyms: 2310050L06Rik, Msrb
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 76467
Homologene: 56555
Fancg
Name: Fanconi anemia, complementation group G
Synonyms: Xrcc9
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 60534
HGNC: HGNC:3588
Homologene: 3402
Or4l15
Name: olfactory receptor family 4 subfamily L member 15
Synonyms: GA_x6K02T2PMLR-5645801-5644872, MOR247-2, Olfr724
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 258485
Homologene: 71986
Slc17a1
Name: solute carrier family 17 (sodium phosphate), member 1
Synonyms: Npt1, NAPI-1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20504
Homologene: 48324
Or14j4
Name: olfactory receptor family 14 subfamily J member 4
Synonyms: GA_x6K02T2PSCP-2070203-2069271, MOR218-11P, Olfr115
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 257908
Homologene: 115497
Zdhhc19
Name: zinc finger, DHHC domain containing 19
Synonyms: LOC245308
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 245308
Homologene: 34922
Smok2b
Name: sperm motility kinase 2B
Synonyms: LOC236574
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 236574
Homologene: 128738
Mapk7
Name: mitogen-activated protein kinase 7
Synonyms: ERK5, BMK1, big MAP kinase 1, Erk5-T, b2b2346Clo
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 23939
HGNC: HGNC:6880
Homologene: 2060
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to G, chromosome 1 at 65,168,497 bp (GRCm38)
  • A to T, chromosome 1 at 91,254,258 bp (GRCm38)
  • C to A, chromosome 1 at 91,972,789 bp (GRCm38)
  • T to C, chromosome 1 at 91,972,790 bp (GRCm38)
  • C to A, chromosome 1 at 158,936,193 bp (GRCm38)
  • GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC to GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC, chromosome 1 at 172,128,583 bp (GRCm38)
  • T to G, chromosome 1 at 180,588,115 bp (GRCm38)
  • A to G, chromosome 2 at 19,383,262 bp (GRCm38)
  • A to G, chromosome 2 at 22,635,041 bp (GRCm38)
  • A to G, chromosome 2 at 86,753,938 bp (GRCm38)
  • G to A, chromosome 2 at 101,630,074 bp (GRCm38)
  • G to A, chromosome 2 at 152,004,592 bp (GRCm38)
  • A to G, chromosome 3 at 152,428,283 bp (GRCm38)
  • T to A, chromosome 4 at 11,771,333 bp (GRCm38)
  • C to T, chromosome 4 at 43,006,565 bp (GRCm38)
  • G to A, chromosome 4 at 53,734,854 bp (GRCm38)
  • C to A, chromosome 4 at 55,009,595 bp (GRCm38)
  • A to G, chromosome 4 at 98,969,634 bp (GRCm38)
  • A to T, chromosome 4 at 118,541,892 bp (GRCm38)
  • C to T, chromosome 4 at 125,707,897 bp (GRCm38)
  • T to C, chromosome 5 at 34,898,932 bp (GRCm38)
  • T to A, chromosome 6 at 72,561,087 bp (GRCm38)
  • T to G, chromosome 6 at 129,591,832 bp (GRCm38)
  • A to G, chromosome 7 at 68,212,027 bp (GRCm38)
  • A to G, chromosome 7 at 103,560,575 bp (GRCm38)
  • A to T, chromosome 7 at 139,615,349 bp (GRCm38)
  • T to A, chromosome 8 at 128,707,106 bp (GRCm38)
  • C to T, chromosome 9 at 13,826,908 bp (GRCm38)
  • T to A, chromosome 9 at 15,332,309 bp (GRCm38)
  • A to T, chromosome 9 at 119,339,707 bp (GRCm38)
  • C to A, chromosome 10 at 80,639,814 bp (GRCm38)
  • A to G, chromosome 11 at 57,238,062 bp (GRCm38)
  • T to C, chromosome 11 at 59,132,566 bp (GRCm38)
  • A to G, chromosome 11 at 61,493,709 bp (GRCm38)
  • G to T, chromosome 11 at 75,650,611 bp (GRCm38)
  • T to A, chromosome 11 at 94,457,067 bp (GRCm38)
  • A to T, chromosome 11 at 99,985,818 bp (GRCm38)
  • A to G, chromosome 12 at 44,573,824 bp (GRCm38)
  • T to A, chromosome 12 at 53,141,252 bp (GRCm38)
  • T to C, chromosome 12 at 75,735,187 bp (GRCm38)
  • C to A, chromosome 13 at 23,880,449 bp (GRCm38)
  • T to C, chromosome 13 at 30,925,795 bp (GRCm38)
  • T to A, chromosome 13 at 77,125,456 bp (GRCm38)
  • T to A, chromosome 13 at 119,357,524 bp (GRCm38)
  • A to T, chromosome 14 at 26,927,753 bp (GRCm38)
  • A to G, chromosome 14 at 49,960,424 bp (GRCm38)
  • T to A, chromosome 16 at 32,497,174 bp (GRCm38)
  • A to T, chromosome 16 at 56,231,460 bp (GRCm38)
  • G to A, chromosome 17 at 13,234,750 bp (GRCm38)
  • G to A, chromosome 17 at 34,845,222 bp (GRCm38)
  • T to C, chromosome 17 at 37,610,517 bp (GRCm38)
  • A to G, chromosome 17 at 52,898,514 bp (GRCm38)
  • A to G, chromosome 18 at 37,486,936 bp (GRCm38)
  • C to G, chromosome 18 at 57,363,199 bp (GRCm38)
  • T to C, chromosome 18 at 82,643,925 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9243 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069069-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.