Strain Name:
C57BL/6J-MtgxR9248Btlr/Mmmh
Stock Number:
069073-MU
Citation ID:
RRID:MMRRC_069073-MU
Other Names:
R9248 (G1)
Major Collection:

Strain Information

Nos1
Name: nitric oxide synthase 1, neuronal
Synonyms: nNOS, bNOS, Nos-1, NO, 2310005C01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18125
HGNC: HGNC:7872
Homologene: 37327
Sash1
Name: SAM and SH3 domain containing 1
Synonyms: A330076K04Rik, 1100001C18Rik, 2500002E12Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70097
Homologene: 69182
Ehmt1
Name: euchromatic histone methyltransferase 1
Synonyms: 9230102N17Rik, KMT1D
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 77683
Homologene: 11698
Dnmt1
Name: DNA methyltransferase 1
Synonyms: MTase, Dnmt1o, Cxxc9, MommeD2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 13433
VEGA: 9
HGNC: HGNC:2976
Homologene: 124071
Gpa33
Name: glycoprotein A33 transmembrane
Synonyms: A33 antigen, 2210401D16Rik, 2010310L10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 59290
HGNC: HGNC:4445
Homologene: 4245
Nsrp1
Name: nuclear speckle regulatory protein 1
Synonyms: NSpr70, Ccdc55
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237859
Homologene: 134095
Heatr5a
Name: HEAT repeat containing 5A
Synonyms: D930036F22Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 320487
VEGA: 12
Homologene: 19635
Ecel1
Name: endothelin converting enzyme-like 1
Synonyms: DINE, XCE
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13599
HGNC: HGNC:3147
Homologene: 3549
Layn
Name: layilin
Synonyms: LOC244864, E030012M19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244864
VEGA: 9
Homologene: 18716
Apob
Name: apolipoprotein B
Synonyms: apob-100, apob-48
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238055
HGNC: HGNC:603
Homologene: 328
Alg2
Name: ALG2 alpha-1,3/1,6-mannosyltransferase
Synonyms: ALPG2, CDGIi, 1300013N08Rik, 1110018A23Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56737
Homologene: 5930
Ostm1
Name: osteopetrosis associated transmembrane protein 1
Synonyms: gl, 1200002H13Rik, HSPC019
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14628
Homologene: 32203
St14
Name: suppression of tumorigenicity 14 (colon carcinoma)
Synonyms: Prss14, Epithin, MT-SP1, matriptase, Tmprss14
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19143
Homologene: 7906
Taf9
Name: TATA-box binding protein associated factor 9
Synonyms: 2310012M09Rik, Taf2g
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 108143
Homologene: 39986
Uggt1
Name: UDP-glucose glycoprotein glucosyltransferase 1
Synonyms: C820010P03Rik, 0910001L17Rik, A930007H10Rik, Ugcgl1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 320011
Homologene: 10586
Uxs1
Name: UDP-glucuronate decarboxylase 1
Synonyms: 1600025I13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 67883
Homologene: 41609
Vat1
Name: vesicle amine transport 1
Synonyms: VAT-1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 26949
Homologene: 36200
Cnbd1
Name: cyclic nucleotide binding domain containing 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 435772
Homologene: 27843
Fig4
Name: FIG4 phosphoinositide 5-phosphatase
Synonyms: A530089I17Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103199
VEGA: 10
Homologene: 6713
Syne2
Name: spectrin repeat containing, nuclear envelope 2
Synonyms: nesprin-2, syne-2, D12Ertd777e, 6820443O06Rik, Nesp2g, Cpfl8, diminished cone electroretinogram, dice
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319565
Homologene: 56700
Slc9c1
Name: solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
Synonyms: LOC208169, spermNHE, Slc9a10
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 208169
Homologene: 19505
Mroh4
Name: maestro heat-like repeat family member 4
Synonyms: 1700016M24Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 69439
Homologene: 72545
Stab2
Name: stabilin 2
Synonyms: STAB-2, FEEL-2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 192188
Homologene: 23022
Tmem132e
Name: transmembrane protein 132E
Synonyms: LOC270893
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 270893
Homologene: 41524
Jakmip2
Name: janus kinase and microtubule interacting protein 2
Synonyms: 6430702L21Rik, D930046L20Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 76217
VEGA: 18
Homologene: 8866
C8a
Name: complement component 8, alpha polypeptide
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230558
HGNC: HGNC:1352
Homologene: 472
Pcdhb13
Name: protocadherin beta 13
Synonyms: PcdhbM, Pcdbh6
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93884
HGNC: HGNC:8691
Homologene: 10338
Rnh1
Name: ribonuclease/angiogenin inhibitor 1
Synonyms: RNH
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 107702
Homologene: 2204
Ttc41
Name: tetratricopeptide repeat domain 41
Synonyms: Gnn, BC030307
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103220
VEGA: 10
Homologene: 52968
Heatr9
Name: HEAT repeat containing 9
Synonyms: Gm11435
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 629303
Homologene: 51895
Fbln2
Name: fibulin 2
Synonyms: 5730577E14Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14115
HGNC: HGNC:3601
Homologene: 1514
Mdga2
Name: MAM domain containing glycosylphosphatidylinositol anchor 2
Synonyms: Mdga2, 9330209L04Rik, 6720489L24Rik, Mamdc1, Adp
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 320772
Homologene: 45659
Speg
Name: SPEG complex locus
Synonyms: BPEG, SPEGbeta, SPEGalpha, D1Bwg1450e, SPEG, Apeg1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11790
Homologene: 55619
Zfp944
Name: zinc finger protein 944
Synonyms: 6330416L07Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 319615
VEGA: 17
Homologene: 133237
Tpte
Name: transmembrane phosphatase with tensin homology
Synonyms: Pten2, Vsp
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234129
Homologene: 50411
Mboat1
Name: membrane bound O-acyltransferase domain containing 1
Synonyms: 9130215M02Rik, Oact1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218121
Homologene: 57467
Pfpl
Name: pore forming protein-like
Synonyms: Epcs5, Epcs50
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 56093
VEGA: 19
Homologene: 130704
Zfp956
Name: zinc finger protein 956
Synonyms: AI894139
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 101197
Homologene: 128449
Plin5
Name: perilipin 5
Synonyms: MLDP, Lsdp5, 2310076L09Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 66968
Homologene: 41654
Acaa1b
Name: acetyl-Coenzyme A acyltransferase 1B
Synonyms: thiolase B
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235674
HGNC: HGNC:82
Homologene: 91131
C1ra
Name: complement component 1, r subcomponent A
Synonyms: mC1rA
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 50909
HGNC: HGNC:1246
Homologene: 1313
Ces1g
Name: carboxylesterase 1G
Synonyms: Ces-1, Ses-1, Ces1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12623
HGNC: HGNC:1863
Homologene: 137354
Zfp780b
Name: zinc finger protein 780B
Synonyms: B230208L21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 338354
Homologene: 85969
Dok1
Name: docking protein 1
Synonyms: p62DOK
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13448
HGNC: HGNC:2990
Homologene: 1057
Or8c16
Name: olfactory receptor family 8 subfamily C member 16
Synonyms: GA_x6K02T2PVTD-31898993-31899934, MOR170-5, Olfr894
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258868
Krt1
Name: keratin 1
Synonyms: Krt2-1, Krt-2.1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16678
VEGA: 15
HGNC: HGNC:6412
Homologene: 38146
Ccdc185
Name: coiled-coil domain containing 185
Synonyms: 4922505E12Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 433386
Homologene: 17631
Akr1c19
Name: aldo-keto reductase family 1, member C19
Synonyms: 1810010N06Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 432720
HGNC: HGNC:387
Homologene: 134145
Or5p59
Name: olfactory receptor family 5 subfamily P member 59
Synonyms: GA_x6K02T2PBJ9-10432095-10433042, MOR204-12, Olfr483
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258730
Homologene: 133602
Crybb2
Name: crystallin, beta B2
Synonyms: betaB2-crystallin, Cryb-2, Aey2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12961
HGNC: HGNC:2398
Homologene: 420
Dcaf5
Name: DDB1 and CUL4 associated factor 5
Synonyms: BCRP2, BCRG2, 9430020B07Rik, Wdr22
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 320808
VEGA: 12
Homologene: 18564
Wdr81
Name: WD repeat domain 81
Synonyms: shakey 5, MGC32441, nur5
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192652
Homologene: 13983
Thumpd2
Name: THUMP domain containing 2
Synonyms: 2810025A12Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 72167
VEGA: 17
Homologene: 11898
Mblac2
Name: metallo-beta-lactamase domain containing 2
Synonyms: 2900024O10Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 72852
VEGA: 13
Homologene: 15174
Rmi1
Name: RecQ mediated genome instability 1
Synonyms: 4932432N11Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 74386
VEGA: 13
Homologene: 41601
Agpat2
Name: 1-acylglycerol-3-phosphate O-acyltransferase 2
Synonyms: LPAAT-beta, BSCL1, 2510002J07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67512
HGNC: HGNC:325
Homologene: 4678
Nicn1
Name: nicolin 1
Synonyms: 1500032A17Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 66257
Homologene: 11936
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to C, chromosome 1 at 36,210,022 bp (GRCm38)
  • A to G, chromosome 1 at 43,764,924 bp (GRCm38)
  • A to C, chromosome 1 at 75,421,776 bp (GRCm38)
  • A to G, chromosome 1 at 87,153,390 bp (GRCm38)
  • A to G, chromosome 1 at 166,163,827 bp (GRCm38)
  • A to G, chromosome 1 at 182,748,656 bp (GRCm38)
  • A to T, chromosome 2 at 24,848,065 bp (GRCm38)
  • A to G, chromosome 2 at 26,593,589 bp (GRCm38)
  • T to C, chromosome 4 at 18,862,113 bp (GRCm38)
  • A to G, chromosome 4 at 47,474,001 bp (GRCm38)
  • T to C, chromosome 4 at 104,846,002 bp (GRCm38)
  • C to T, chromosome 5 at 113,063,228 bp (GRCm38)
  • G to C, chromosome 5 at 117,879,337 bp (GRCm38)
  • G to T, chromosome 6 at 47,957,503 bp (GRCm38)
  • T to A, chromosome 6 at 83,031,912 bp (GRCm38)
  • T to A, chromosome 6 at 91,254,574 bp (GRCm38)
  • A to T, chromosome 6 at 124,512,621 bp (GRCm38)
  • C to T, chromosome 7 at 27,973,718 bp (GRCm38)
  • T to C, chromosome 7 at 108,104,049 bp (GRCm38)
  • T to C, chromosome 7 at 141,160,801 bp (GRCm38)
  • A to G, chromosome 8 at 22,351,473 bp (GRCm38)
  • A to G, chromosome 8 at 93,333,691 bp (GRCm38)
  • A to G, chromosome 9 at 20,922,112 bp (GRCm38)
  • T to C, chromosome 9 at 31,091,609 bp (GRCm38)
  • T to C, chromosome 9 at 38,219,410 bp (GRCm38)
  • A to G, chromosome 9 at 51,057,460 bp (GRCm38)
  • C to T, chromosome 9 at 108,294,509 bp (GRCm38)
  • T to C, chromosome 9 at 119,153,934 bp (GRCm38)
  • C to A, chromosome 10 at 8,741,532 bp (GRCm38)
  • C to T, chromosome 10 at 41,277,482 bp (GRCm38)
  • T to C, chromosome 10 at 42,698,214 bp (GRCm38)
  • T to A, chromosome 10 at 86,731,249 bp (GRCm38)
  • T to A, chromosome 10 at 86,891,617 bp (GRCm38)
  • G to T, chromosome 11 at 75,445,430 bp (GRCm38)
  • G to A, chromosome 11 at 77,046,210 bp (GRCm38)
  • A to G, chromosome 11 at 82,444,482 bp (GRCm38)
  • A to T, chromosome 11 at 83,518,455 bp (GRCm38)
  • A to T, chromosome 11 at 101,460,554 bp (GRCm38)
  • C to T, chromosome 12 at 8,015,231 bp (GRCm38)
  • T to C, chromosome 12 at 51,916,243 bp (GRCm38)
  • A to G, chromosome 12 at 66,689,452 bp (GRCm38)
  • C to T, chromosome 12 at 76,107,456 bp (GRCm38)
  • T to C, chromosome 12 at 80,339,789 bp (GRCm38)
  • C to A, chromosome 13 at 4,242,975 bp (GRCm38)
  • A to G, chromosome 13 at 30,226,409 bp (GRCm38)
  • A to G, chromosome 13 at 58,409,085 bp (GRCm38)
  • A to G, chromosome 13 at 81,711,650 bp (GRCm38)
  • T to A, chromosome 13 at 100,654,352 bp (GRCm38)
  • C to T, chromosome 15 at 74,613,318 bp (GRCm38)
  • AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC to AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC, chromosome 15 at 101,850,378 bp (GRCm38)
  • A to G, chromosome 16 at 45,550,188 bp (GRCm38)
  • A to T, chromosome 17 at 22,343,638 bp (GRCm38)
  • A to T, chromosome 17 at 56,112,324 bp (GRCm38)
  • G to A, chromosome 17 at 81,026,611 bp (GRCm38)
  • A to T, chromosome 18 at 37,444,555 bp (GRCm38)
  • A to C, chromosome 18 at 43,552,177 bp (GRCm38)
  • T to A, chromosome 19 at 12,429,010 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9248 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069073-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.