Strain Name:
C57BL/6J-MtgxR9288Btlr/Mmmh
Stock Number:
069107-MU
Citation ID:
RRID:MMRRC_069107-MU
Other Names:
R9288 (G1)
Major Collection:

Strain Information

Kmt2c
Name: lysine (K)-specific methyltransferase 2C
Synonyms: E330008K23Rik, HALR, Mll3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231051
Homologene: 46480
Myh7
Name: myosin, heavy polypeptide 7, cardiac muscle, beta
Synonyms: Myhc-b, Myhcb, MYH-beta/slow, beta-MHC, B-MHC, MyHC-I, betaMHC
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 140781
HGNC: HGNC:7577
Homologene: 68044
Cacna1g
Name: calcium channel, voltage-dependent, T type, alpha 1G subunit
Synonyms: a1G, Cav3.1d
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12291
HGNC: HGNC:1394
Homologene: 22544
Olr1
Name: oxidized low density lipoprotein (lectin-like) receptor 1
Synonyms: LOX-1, Scare1, SR-EI
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 108078
HGNC: HGNC:8133
Homologene: 1910
Slit1
Name: slit guidance ligand 1
Synonyms: Slil1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20562
Homologene: 2302
Osbpl1a
Name: oxysterol binding protein-like 1A
Synonyms: LOC328902, G430090F17Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 64291
Homologene: 84746
Epb41l2
Name: erythrocyte membrane protein band 4.1 like 2
Synonyms: NBL2, 4.1G, D10Ertd398e, Epb4.1l2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13822
VEGA: 10
HGNC: HGNC:3379
Homologene: 37478
Acot7
Name: acyl-CoA thioesterase 7
Synonyms: 2410041A17Rik, Bach, AU014716
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 70025
Homologene: 15780
Dlgap4
Name: DLG associated protein 4
Synonyms: WBP16, SAP90/PSD-95-associated protein 4, PSD-95/SAP90 binding protein 4, DAP4, Sapap4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228836
Homologene: 8935
Hdlbp
Name: high density lipoprotein (HDL) binding protein
Synonyms: D1Ertd101e, 1110005P14Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 110611
HGNC: HGNC:4857
Homologene: 38035
Sfpq
Name: splicing factor proline/glutamine rich (polypyrimidine tract binding protein associated)
Synonyms: D4Ertd314e, 9030402K04Rik, 2810416M14Rik, 5730453G22Rik, 1110004P21Rik, REP1, PSF
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 71514
Homologene: 3714
Flnb
Name: filamin, beta
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 286940
HGNC: HGNC:3755
Homologene: 37480
Gpa33
Name: glycoprotein A33 transmembrane
Synonyms: A33 antigen, 2210401D16Rik, 2010310L10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 59290
HGNC: HGNC:4445
Homologene: 4245
Sulf1
Name: sulfatase 1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240725
Homologene: 49408
Rsf1
Name: remodeling and spacing factor 1
Synonyms: p325, XAP8, Hbxap, C030033M12Rik, 4832420A03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233532
Homologene: 41142
Nsmaf
Name: neutral sphingomyelinase (N-SMase) activation associated factor
Synonyms: Fan, factor associated with N-SMase activation
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18201
HGNC: HGNC:8017
Homologene: 2652
Hook1
Name: hook microtubule tethering protein 1
Synonyms: abnormal spermatozoon head shape, azh, A930033L17Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 77963
Homologene: 9289
Cit
Name: citron
Synonyms: CRIK-SK, citron-N, citron kinase, Cit-k, C030025P15Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12704
HGNC: HGNC:1985
Homologene: 21404
C6
Name: complement component 6
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12274
HGNC: HGNC:1339
Homologene: 47
Vdac2
Name: voltage-dependent anion channel 2
Synonyms: Vdac6
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 22334
Homologene: 37765
Acsf2
Name: acyl-CoA synthetase family member 2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 264895
Homologene: 23519
Sorl1
Name: sortilin-related receptor, LDLR class A repeats-containing
Synonyms: LR11, mSorLA, 2900010L19Rik, Sorla
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20660
Homologene: 2336
Prdm10
Name: PR domain containing 10
Synonyms: tristanin, LOC382066
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 382066
Homologene: 45718
Mex3a
Name: mex3 RNA binding family member A
Synonyms: Rkhd4, 2700083E18Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 72640
Homologene: 18950
Isx
Name: intestine specific homeobox
Synonyms: 9130012O13Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 71597
Homologene: 28312
Zfp608
Name: zinc finger protein 608
Synonyms: 4932417D18Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 269023
VEGA: 18
Homologene: 18485
Pcsk5
Name: proprotein convertase subtilisin/kexin type 5
Synonyms: PC6, SPC6, PC5A, PC5/6A, b2b585Clo, b2b1549Clo
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18552
VEGA: 19
HGNC: HGNC:8747
Homologene: 21244
Neb
Name: nebulin
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17996
HGNC: HGNC:7720
Homologene: 136285
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: LOC380698, OTTMUSG00000005786
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380698
Homologene: 70869
Col14a1
Name: collagen, type XIV, alpha 1
Synonyms: 5730412L22Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12818
HGNC: HGNC:2191
Homologene: 18741
Apba1
Name: amyloid beta precursor protein binding family A member 1
Synonyms: X11alpha, Lin-10, X11, Mint1, Mint, 6430513E09Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 319924
VEGA: 19
HGNC: HGNC:578
Homologene: 897
Gtf2ird2
Name: GTF2I repeat domain containing 2
Synonyms: 1700012P16Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 114674
Homologene: 24941
Lpin3
Name: lipin 3
Synonyms: 9130206L11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 64899
Homologene: 84844
Klhl10
Name: kelch-like 10
Synonyms: 4921517C11Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 66720
Homologene: 12018
Qrich2
Name: glutamine rich 2
Synonyms: LOC217341
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217341
Homologene: 12951
Eml6
Name: echinoderm microtubule associated protein like 6
Synonyms: 2900083P10Rik, C230094A16Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237711
Homologene: 104282
Spata17
Name: spermatogenesis associated 17
Synonyms: 4930504I07Rik, 1700065F16Rik, 4930513F16Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74717
Homologene: 12551
BC028528
Name: cDNA sequence BC028528
Synonyms: L259
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229600
Homologene: 49773
Lrrc9
Name: leucine rich repeat containing 9
Synonyms: 4930432K16Rik, 4921529O18Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 78257
Homologene: 12692
Tbc1d4
Name: TBC1 domain family, member 4
Synonyms: 5930406J04Rik, AS160
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 210789
Homologene: 45451
Apcdd1
Name: adenomatosis polyposis coli down-regulated 1
Synonyms: EIG180, Drapc1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 494504
VEGA: 18
Homologene: 77420
Mex3b
Name: mex3 RNA binding family member B
Synonyms: 4931439A04Rik, Rkhd3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 108797
Homologene: 13570
Rnf180
Name: ring finger protein 180
Synonyms: 3110001E11Rik, Rines
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 71816
VEGA: 13
Homologene: 18677
Rft1
Name: RFT1 homolog
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 328370
Homologene: 5343
Vmn2r112
Name: vomeronasal 2, receptor 112
Synonyms: EG628185
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 628185
Homologene: 86604
Ptprb
Name: protein tyrosine phosphatase receptor type B
Synonyms: 3230402H02Rik, VE-PTP
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19263
VEGA: 10
HGNC: HGNC:9665
Homologene: 2125
Poll
Name: polymerase (DNA directed), lambda
Synonyms: 1110003P06Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 56626
VEGA: 19
HGNC: HGNC:9184
Homologene: 40863
Bbs12
Name: Bardet-Biedl syndrome 12
Synonyms: LOC241950, LOC241950, LOC386537
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 241950
Homologene: 17634
Vmn2r8
Name: vomeronasal 2, receptor 8
Synonyms: EG627479
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 627479
Homologene: 129606
Asz1
Name: ankyrin repeat, SAM and basic leucine zipper domain containing 1
Synonyms: ORF3, 4933400N19Rik, Gasz
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74068
HGNC: HGNC:1350
Homologene: 11374
Fbln5
Name: fibulin 5
Synonyms: EVEC
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 23876
VEGA: 12
HGNC: HGNC:3602
Homologene: 38170
Gm4553
Name: predicted gene 4553
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100043617
Tmem88b
Name: transmembrane protein 88B
Synonyms: A230069A22Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320587
Homologene: 85849
Tgfbr2
Name: transforming growth factor, beta receptor II
Synonyms: TbetaR-II, TbetaRII, 1110020H15Rik, TBR-II
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 21813
VEGA: 9
Homologene: 2435
1700012B07Rik
Name: RIKEN cDNA 1700012B07 gene
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69324
Homologene: 78000
Nkd2
Name: naked cuticle 2
Synonyms: 2210403L10Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 72293
Homologene: 12459
Glyatl3
Name: glycine-N-acyltransferase-like 3
Synonyms: Gm5683
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 435528
VEGA: 17
Homologene: 19824
Agmat
Name: agmatinase
Synonyms: 5033405N08Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 75986
Homologene: 99855
Chst13
Name: carbohydrate sulfotransferase 13
Synonyms: Chst13, 1110067M19Rik, C4ST-3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 71797
Homologene: 44360
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • G to A, chromosome 1 at 12,786,603 bp (GRCm38)
  • T to C, chromosome 1 at 93,409,051 bp (GRCm38)
  • G to A, chromosome 1 at 166,152,735 bp (GRCm38)
  • A to G, chromosome 1 at 187,112,559 bp (GRCm38)
  • T to G, chromosome 2 at 52,161,391 bp (GRCm38)
  • G to T, chromosome 2 at 156,704,594 bp (GRCm38)
  • C to A, chromosome 2 at 160,903,632 bp (GRCm38)
  • C to T, chromosome 3 at 37,320,563 bp (GRCm38)
  • T to A, chromosome 3 at 88,536,151 bp (GRCm38)
  • T to C, chromosome 3 at 95,891,915 bp (GRCm38)
  • T to C, chromosome 4 at 6,414,976 bp (GRCm38)
  • C to T, chromosome 4 at 96,013,268 bp (GRCm38)
  • T to C, chromosome 4 at 127,022,834 bp (GRCm38)
  • T to C, chromosome 4 at 141,747,080 bp (GRCm38)
  • T to A, chromosome 4 at 152,206,806 bp (GRCm38)
  • A to T, chromosome 4 at 155,784,276 bp (GRCm38)
  • A to T, chromosome 5 at 25,292,909 bp (GRCm38)
  • A to T, chromosome 5 at 25,349,862 bp (GRCm38)
  • A to T, chromosome 5 at 108,802,319 bp (GRCm38)
  • C to T, chromosome 5 at 115,985,453 bp (GRCm38)
  • A to G, chromosome 5 at 134,192,732 bp (GRCm38)
  • A to G, chromosome 6 at 18,051,369 bp (GRCm38)
  • G to A, chromosome 6 at 90,309,524 bp (GRCm38)
  • T to C, chromosome 6 at 129,493,239 bp (GRCm38)
  • T to C, chromosome 7 at 82,868,951 bp (GRCm38)
  • GGCGGCGGC to GGCGGCGGCCGCGGCGGC, chromosome 7 at 97,579,912 bp (GRCm38)
  • GCAGCCCCCACAGGAACTACAACCACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGA to GCAGCCCCCACAGGA, chromosome 7 at 142,165,288 bp (GRCm38)
  • G to T, chromosome 8 at 74,892,811 bp (GRCm38)
  • A to G, chromosome 9 at 31,341,378 bp (GRCm38)
  • A to G, chromosome 9 at 42,041,631 bp (GRCm38)
  • T to C, chromosome 9 at 116,110,081 bp (GRCm38)
  • A to G, chromosome 10 at 25,479,755 bp (GRCm38)
  • T to A, chromosome 10 at 116,319,448 bp (GRCm38)
  • T to G, chromosome 11 at 29,838,641 bp (GRCm38)
  • A to T, chromosome 11 at 59,085,223 bp (GRCm38)
  • T to A, chromosome 11 at 94,418,071 bp (GRCm38)
  • C to T, chromosome 11 at 94,573,218 bp (GRCm38)
  • G to T, chromosome 11 at 100,456,893 bp (GRCm38)
  • T to C, chromosome 11 at 109,813,618 bp (GRCm38)
  • GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG to GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG, chromosome 11 at 116,457,541 bp (GRCm38)
  • T to A, chromosome 12 at 72,476,084 bp (GRCm38)
  • A to T, chromosome 12 at 101,768,469 bp (GRCm38)
  • G to T, chromosome 13 at 73,847,058 bp (GRCm38)
  • CGAGG to CGAGGAGG, chromosome 13 at 105,250,273 bp (GRCm38)
  • A to C, chromosome 14 at 7,904,498 bp (GRCm38)
  • C to A, chromosome 14 at 21,831,894 bp (GRCm38)
  • A to T, chromosome 14 at 30,661,458 bp (GRCm38)
  • A to T, chromosome 14 at 54,985,475 bp (GRCm38)
  • T to C, chromosome 14 at 101,454,872 bp (GRCm38)
  • A to C, chromosome 15 at 4,806,050 bp (GRCm38)
  • T to A, chromosome 15 at 55,423,522 bp (GRCm38)
  • A to G, chromosome 17 at 22,603,342 bp (GRCm38)
  • A to G, chromosome 17 at 40,910,125 bp (GRCm38)
  • A to G, chromosome 18 at 12,771,345 bp (GRCm38)
  • G to T, chromosome 18 at 54,900,269 bp (GRCm38)
  • C to T, chromosome 18 at 62,922,660 bp (GRCm38)
  • T to C, chromosome 19 at 17,836,981 bp (GRCm38)
  • A to G, chromosome 19 at 23,945,781 bp (GRCm38)
  • A to T, chromosome 19 at 41,624,705 bp (GRCm38)
  • T to C, chromosome 19 at 45,558,842 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9288 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069107-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.