Strain Name:
C57BL/6J-MtgxR9356Btlr/Mmmh
Stock Number:
069165-MU
Citation ID:
RRID:MMRRC_069165-MU
Other Names:
R9356 (G1)
Major Collection:

Strain Information

Chrna7
Name: cholinergic receptor, nicotinic, alpha polypeptide 7
Synonyms: Acra7, alpha7, alpha7 nicotinic receptor, alpha7-nAChR
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11441
Homologene: 593
Arrdc4
Name: arrestin domain containing 4
Synonyms: 2410003C09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66412
Homologene: 41636
Mdm4
Name: transformed mouse 3T3 cell double minute 4
Synonyms: Mdmx, 4933417N07Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17248
HGNC: HGNC:6974
Homologene: 1794
Uba3
Name: ubiquitin-like modifier activating enzyme 3
Synonyms: ubiquitin activating enzyme 3, A830034N06Rik, Ube1c
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 22200
Homologene: 2951
Rxra
Name: retinoid X receptor alpha
Synonyms: RXRalpha1, RXR alpha 1, 9530071D11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20181
Homologene: 2220
Ythdf1
Name: YTH N6-methyladenosine RNA binding protein 1
Synonyms: 2210410K23Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228994
Homologene: 9844
Baz1b
Name: bromodomain adjacent to zinc finger domain, 1B
Synonyms: Wbscr9, WSTF
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22385
HGNC: HGNC:961
Homologene: 22651
Ago3
Name: argonaute RISC catalytic subunit 3
Synonyms: argonaute 3, eIF2C3, C130014L07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 214150
Homologene: 49799
Ints9
Name: integrator complex subunit 9
Synonyms: D14Ertd231e
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 210925
VEGA: 14
Homologene: 10096
Calcr
Name: calcitonin receptor
Synonyms: Clr
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12311
HGNC: HGNC:1440
Homologene: 1320
Ifnar1
Name: interferon (alpha and beta) receptor 1
Synonyms: Ifrc, Ifar, IFN-alpha/betaR
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 15975
HGNC: HGNC:5432
Homologene: 524
Lig4
Name: ligase IV, DNA, ATP-dependent
Synonyms: DNA ligase IV, 5830471N16Rik, tiny
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 319583
HGNC: HGNC:6601
Homologene: 1736
Mindy1
Name: MINDY lysine 48 deubiquitinase 1
Synonyms: cI-40, 1810005H09Rik, NF-E2 inducible protein, 4930504E06Rik, Fam63a
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 75007
Homologene: 32409
Zfp979
Name: zinc finger protein 979
Synonyms: 2610305D13Rik, Ssm1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 112422
Homologene: 133076
Pja2
Name: praja ring finger ubiquitin ligase 2
Synonyms: Neurodap1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224938
Homologene: 32233
Csmd1
Name: CUB and Sushi multiple domains 1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 94109
Homologene: 69536
Myo7a
Name: myosin VIIA
Synonyms: Myo7, USH1B, nmf371, polka, Hdb
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17921
HGNC: HGNC:7606
Homologene: 219
Primpol
Name: primase and polymerase (DNA-directed)
Synonyms: Ccdc111
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 408022
Homologene: 14065
Rundc3a
Name: RUN domain containing 3A
Synonyms: Rpip8, Rap2ip
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 51799
Homologene: 4871
Abca13
Name: ATP-binding cassette, sub-family A member 13
Synonyms: A930002G16Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268379
Homologene: 27991
Ksr2
Name: kinase suppressor of ras 2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 333050
Homologene: 45469
Lama2
Name: laminin, alpha 2
Synonyms: merosin, mer
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16773
HGNC: HGNC:6482
Homologene: 37306
Mroh4
Name: maestro heat-like repeat family member 4
Synonyms: 1700016M24Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 69439
Homologene: 72545
Ctss
Name: cathepsin S
Synonyms: Cat S
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 13040
HGNC: HGNC:2545
Homologene: 20867
Myo7b
Name: myosin VIIB
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 17922
HGNC: HGNC:7607
Homologene: 81947
Or8h7
Name: olfactory receptor family 8 subfamily H member 7
Synonyms: GA_x6K02T2Q125-48376288-48375341, MOR206-2, Olfr1097
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258840
Homologene: 37005
Ankrd50
Name: ankyrin repeat domain 50
Synonyms: E430012K20Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99696
Homologene: 129859
Jmjd4
Name: jumonji domain containing 4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 194952
Homologene: 11306
Zfp770
Name: zinc finger protein 770
Synonyms: 6430601A21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228491
Homologene: 82354
Otogl
Name: otogelin-like
Synonyms: Gm6924
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 628870
Homologene: 46008
Cyp4a12a
Name: cytochrome P450, family 4, subfamily a, polypeptide 12a
Synonyms: Cyp4a12
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 277753
Homologene: 134044
Spata31h1
Name: SPATA31 subfamily H member 1
Synonyms: 4932415D10Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 102635990
VEGA: 10
Homologene: 82476
Prss36
Name: serine protease 36
Synonyms: polyserase-2, C330007D15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 77613
Homologene: 18303
Lman2l
Name: lectin, mannose-binding 2-like
Synonyms: VIP36-like, A630028F14Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 214895
Homologene: 57125
Slc14a2
Name: solute carrier family 14 (urea transporter), member 2
Synonyms: UT-A3, UT-A5
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 27411
VEGA: 18
Homologene: 5183
Igfn1
Name: immunoglobulin-like and fibronectin type III domain containing 1
Synonyms: 9830123M21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226438
Homologene: 130054
Mfsd10
Name: major facilitator superfamily domain containing 10
Synonyms: 0610009O03Rik, Tetran
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 68294
Homologene: 871
Spam1
Name: sperm adhesion molecule 1
Synonyms: Ph-20
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20690
Homologene: 7547
Gm10549
Name: predicted gene 10549
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 433171
VEGA: 18
Cldn15
Name: claudin 15
Synonyms: 2210009B08Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 60363
HGNC: HGNC:2036
Homologene: 8646
Apba2
Name: amyloid beta precursor protein binding family A member 2
Synonyms: X11-like, X11L, Mint 2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11784
HGNC: HGNC:579
Homologene: 4021
Or5w15
Name: olfactory receptor family 5 subfamily W member 15
Synonyms: GA_x6K02T2Q125-49242149-49241214, MOR177-8, Olfr1138
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258632
Homologene: 74082
Lmtk3
Name: lemur tyrosine kinase 3
Synonyms: Aatyk3, AATYK3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381983
Homologene: 79449
Or52n5
Name: olfactory receptor family 52 subfamily N member 5
Synonyms: GA_x6K02T2PBJ9-7567376-7568329, MOR34-6, Olfr669
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259045
Homologene: 72057
Sdsl
Name: serine dehydratase-like
Synonyms: SDS-RS1, 4432411H13Rik, SDH1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 257635
Homologene: 44224
Gpr162
Name: G protein-coupled receptor 162
Synonyms: A-2, Grca
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14788
Homologene: 8400
Stbd1
Name: starch binding domain 1
Synonyms: D530019K15Rik, D5Ertd593e
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 52331
Homologene: 2929
Or6c65
Name: olfactory receptor family 6 subfamily C member 65
Synonyms: GA_x6K02T2PULF-11446184-11447122, MOR112-2, Olfr808
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258930
Homologene: 17438
Lce1f
Name: late cornified envelope 1F
Synonyms: 1110055J05Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67828
Ttc39c
Name: tetratricopeptide repeat domain 39C
Synonyms: 1700008N02Rik, 2810439F02Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 72747
Homologene: 124438
Ptpn20
Name: protein tyrosine phosphatase, non-receptor type 20
Synonyms: typ
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 19256
VEGA: 14
Homologene: 74905
Krtap1-4
Name: keratin associated protein 1-4
Synonyms: OTTMUSG00000004966
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 629873
Homologene: 87892
Nudt17
Name: nudix hydrolase 17
Synonyms: 2410015C20Rik, nudix (nucleoside diphosphate linked moiety X)-type motif 17
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 78373
Homologene: 45961
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to G, chromosome 1 at 36,428,334 bp (GRCm38)
  • G to A, chromosome 1 at 133,011,099 bp (GRCm38)
  • A to T, chromosome 1 at 135,972,087 bp (GRCm38)
  • T to A, chromosome 2 at 27,759,663 bp (GRCm38)
  • T to A, chromosome 2 at 86,890,261 bp (GRCm38)
  • T to A, chromosome 2 at 87,737,745 bp (GRCm38)
  • T to C, chromosome 2 at 114,196,436 bp (GRCm38)
  • A to C, chromosome 2 at 180,912,205 bp (GRCm38)
  • A to T, chromosome 3 at 38,456,087 bp (GRCm38)
  • TCCACAGCAGCCACTGCTGCCACCACTGCTGCCACAGCAGCCACTGCTGCCACCACTGCTGCCACAGCAGCCACTGCTGCCACCACTGCT to TCCACAGCAGCCACTGCTGCCACCACTGCTGCCACAGCAGCCACTGCTGCCACCACTGCT, chromosome 3 at 92,718,965 bp (GRCm38)
  • C to T, chromosome 3 at 95,295,279 bp (GRCm38)
  • A to C, chromosome 3 at 95,546,809 bp (GRCm38)
  • T to A, chromosome 3 at 96,706,372 bp (GRCm38)
  • C to A, chromosome 4 at 115,328,718 bp (GRCm38)
  • A to T, chromosome 4 at 126,370,351 bp (GRCm38)
  • G to T, chromosome 4 at 147,613,901 bp (GRCm38)
  • C to A, chromosome 5 at 34,636,704 bp (GRCm38)
  • A to G, chromosome 5 at 92,605,418 bp (GRCm38)
  • T to A, chromosome 5 at 117,689,641 bp (GRCm38)
  • C to T, chromosome 5 at 120,459,883 bp (GRCm38)
  • A to G, chromosome 5 at 135,210,799 bp (GRCm38)
  • T to C, chromosome 5 at 136,968,114 bp (GRCm38)
  • T to C, chromosome 6 at 3,687,408 bp (GRCm38)
  • T to A, chromosome 6 at 24,800,566 bp (GRCm38)
  • T to C, chromosome 6 at 97,184,850 bp (GRCm38)
  • T to C, chromosome 6 at 124,861,334 bp (GRCm38)
  • A to G, chromosome 7 at 45,793,888 bp (GRCm38)
  • A to T, chromosome 7 at 63,107,689 bp (GRCm38)
  • A to T, chromosome 7 at 64,695,673 bp (GRCm38)
  • A to G, chromosome 7 at 68,744,879 bp (GRCm38)
  • T to A, chromosome 7 at 98,076,666 bp (GRCm38)
  • A to G, chromosome 7 at 104,939,166 bp (GRCm38)
  • T to C, chromosome 7 at 127,946,525 bp (GRCm38)
  • A to G, chromosome 8 at 9,972,538 bp (GRCm38)
  • A to T, chromosome 8 at 16,202,055 bp (GRCm38)
  • A to G, chromosome 8 at 46,590,283 bp (GRCm38)
  • T to A, chromosome 10 at 27,212,190 bp (GRCm38)
  • T to C, chromosome 10 at 82,289,323 bp (GRCm38)
  • T to C, chromosome 10 at 107,782,029 bp (GRCm38)
  • T to G, chromosome 10 at 129,768,166 bp (GRCm38)
  • G to A, chromosome 11 at 9,256,305 bp (GRCm38)
  • T to A, chromosome 11 at 59,454,935 bp (GRCm38)
  • G to A, chromosome 11 at 99,583,343 bp (GRCm38)
  • T to C, chromosome 11 at 102,402,064 bp (GRCm38)
  • T to G, chromosome 14 at 33,630,908 bp (GRCm38)
  • T to C, chromosome 14 at 65,032,321 bp (GRCm38)
  • T to C, chromosome 15 at 74,610,911 bp (GRCm38)
  • C to T, chromosome 16 at 91,495,479 bp (GRCm38)
  • A to G, chromosome 17 at 64,311,209 bp (GRCm38)
  • T to A, chromosome 18 at 12,720,045 bp (GRCm38)
  • C to A, chromosome 18 at 31,977,043 bp (GRCm38)
  • C to T, chromosome 18 at 33,464,322 bp (GRCm38)
  • A to C, chromosome 18 at 78,184,608 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9356 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069165-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.