Strain Name:
C57BL/6J-MtgxR9403Btlr/Mmmh
Stock Number:
069207-MU
Citation ID:
RRID:MMRRC_069207-MU
Other Names:
R9403 (G1)
Major Collection:

Strain Information

Apoa5
Name: apolipoprotein A-V
Synonyms: RAP3, Apoav, 1300007O05Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 66113
Homologene: 14197
Txndc2
Name: thioredoxin domain containing 2 (spermatozoa)
Synonyms: Sptrx-1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 213272
VEGA: 17
Homologene: 41856
Dock1
Name: dedicator of cytokinesis 1
Synonyms: D630004B07Rik, 9130006G06Rik, Dock180, b2b3190Clo
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330662
HGNC: HGNC:2987
Homologene: 55575
Slc2a3
Name: solute carrier family 2 (facilitated glucose transporter), member 3
Synonyms: Glut-3, Glut3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20527
Homologene: 74302
Nup205
Name: nucleoporin 205
Synonyms: 3830404O05Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 70699
Homologene: 45971
Dmtf1
Name: cyclin D binding myb like transcription factor 1
Synonyms: Dmp1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 23857
Homologene: 8017
Mms22l
Name: MMS22-like, DNA repair protein
Synonyms: F730047E07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 212377
Homologene: 18874
Muc16
Name: mucin 16
Synonyms: LOC385009, 1110008I14Rik, Gm21044
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73732
Homologene: 141193
Glg1
Name: golgi apparatus protein 1
Synonyms: ESL-1, CFR, MG-160, MG160, CFR-1, Selel
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 20340
HGNC: HGNC:4316
Homologene: 7533
Mkln1
Name: muskelin 1, intracellular mediator containing kelch motifs
Synonyms: A130067F06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 27418
HGNC: HGNC:7109
Homologene: 8305
Naa35
Name: N(alpha)-acetyltransferase 35, NatC auxiliary subunit
Synonyms: A330027C19Rik, A330021G12Rik, C030004C14Rik, Mak10
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 78689
Homologene: 5781
Dpys
Name: dihydropyrimidinase
Synonyms: DHPase, 1300004I01Rik, 1200017I10Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 64705
HGNC: HGNC:3013
Homologene: 20359
Maml2
Name: mastermind like transcriptional coactivator 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270118
Homologene: 134147
Trpm6
Name: transient receptor potential cation channel, subfamily M, member 6
Synonyms: CHAK2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225997
VEGA: 19
Homologene: 9767
Itga4
Name: integrin alpha 4
Synonyms: VLA-4 receptor, alpha 4 subunit
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16401
HGNC: HGNC:6140
Homologene: 37364
Naip5
Name: NLR family, apoptosis inhibitory protein 5
Synonyms: Naip-rs3, Birc1e, Lgn1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17951
HGNC: HGNC:7634
Homologene: 113589
Polq
Name: polymerase (DNA directed), theta
Synonyms: A430110D14Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 77782
HGNC: HGNC:9186
Homologene: 32727
Gpld1
Name: glycosylphosphatidylinositol specific phospholipase D1
Synonyms: 6330541J12Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14756
HGNC: HGNC:4459
Homologene: 1152
Inhba
Name: inhibin beta-A
Synonyms: activin beta-A
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 16323
VEGA: 13
HGNC: HGNC:6066
Homologene: 1653
Fbn2
Name: fibrillin 2
Synonyms: sy, Sne, Fib-2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 14119
VEGA: 18
HGNC: HGNC:3604
Homologene: 1515
Angpt4
Name: angiopoietin 4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11602
HGNC: HGNC:487
Homologene: 36302
Kcnma1
Name: potassium large conductance calcium-activated channel, subfamily M, alpha member 1
Synonyms: Slo, mSlo1, Slo1, MaxiK, BK channel alpha subunit, 5730414M22Rik, BKCa
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 16531
HGNC: HGNC:6284
Homologene: 1693
Slco6c1
Name: solute carrier organic anion transporter family, member 6c1
Synonyms: 4933404A18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74441
Homologene: 65259
Sh2b1
Name: SH2B adaptor protein 1
Synonyms: Irip, SH2-Bb, SH2-B, Sh2bpsm1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20399
Homologene: 32122
Fam187b
Name: family with sequence similarity 187, member B
Synonyms: 1700020B09Rik, Tmem162
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76415
Homologene: 138431
Mylk
Name: myosin, light polypeptide kinase
Synonyms: telokin, Mlck, MLCK210, MLCK108, 9530072E15Rik, A930019C19Rik, nmMlck
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 107589
HGNC: HGNC:7590
Homologene: 14202
Trim61
Name: tripartite motif-containing 61
Synonyms: 2czf61, E330039K03Rik, Rnf35
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 260296
Vcpip1
Name: valosin containing protein (p97)/p47 complex interacting protein 1
Synonyms: 5730421J18Rik, 5730538E15Rik, Vcip135
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 70675
Homologene: 11814
Nup50l
Name: nucleoporin 50 like
Synonyms: 1700123L14Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 78482
HGNC: HGNC:8065
Slc5a7
Name: solute carrier family 5 (choline transporter), member 7
Synonyms: CHT1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 63993
VEGA: 17
Homologene: 32516
Tgm4
Name: transglutaminase 4 (prostate)
Synonyms: experimental autoimmune prostatitis antigen 1, Eapa1, 9530008N10Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 331046
Homologene: 20689
Padi3
Name: peptidyl arginine deiminase, type III
Synonyms: PAD type III, Pad3, Pdi3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18601
Homologene: 7882
Cyp3a41a
Name: cytochrome P450, family 3, subfamily a, polypeptide 41A
Synonyms: steroid inducible, Cyp3a41
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 53973
HGNC: HGNC:2638
Homologene: 133568
Rergl
Name: RERG/RAS-like
Synonyms: EG632971
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 632971
Homologene: 41583
Semp2l2b
Name: SUMO/sentrin specific peptidase 2-like 2B
Synonyms: 4930444G20Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 114671
Homologene: 130042
Rptn
Name: repetin
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20129
Homologene: 84780
Ptgdr
Name: prostaglandin D receptor
Synonyms: DP
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 19214
HGNC: HGNC:9591
Homologene: 736
Gm5591
Name: predicted gene 5591
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434171
Homologene: 80005
Or4l1
Name: olfactory receptor family 4 subfamily L member 1
Synonyms: GA_x6K02T2PMLR-5600424-5599495, MOR247-3P, MOR247-4, Olfr723
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 259147
Homologene: 71986
Qsox1
Name: quiescin Q6 sulfhydryl oxidase 1
Synonyms: 1300003H02Rik, Qscn6, QSOX, b2b2673Clo
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 104009
HGNC: HGNC:9756
Homologene: 37690
Txndc9
Name: thioredoxin domain containing 9
Synonyms: ATP binding protein associated with cell differentiation, Apacd
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98258
Homologene: 4225
Or2w1
Name: olfactory receptor family 2 subfamily W member 1
Synonyms: IA3, GA_x6K02T2N5E5-9379-8514, MOR256-37P, MOR256-31, GA_x6K02T2QHY8-12114828-12113875, MOR256-61, Olfr42, Olfr263-ps1, Olfr263
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18341
HGNC: HGNC:8281
Homologene: 12791
Malrd1
Name: MAM and LDL receptor class A domain containing 1
Synonyms: Gm13318, Gm13364, Diet1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 102635496
Homologene: 136214
Zfp383
Name: zinc finger protein 383
Synonyms: 1110003H10Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 73729
Homologene: 128413
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to G, chromosome 1 at 9,745,824 bp (GRCm38)
  • T to C, chromosome 1 at 37,995,778 bp (GRCm38)
  • A to T, chromosome 1 at 97,062,523 bp (GRCm38)
  • A to G, chromosome 1 at 155,782,597 bp (GRCm38)
  • T to C, chromosome 2 at 15,614,177 bp (GRCm38)
  • T to A, chromosome 2 at 79,325,660 bp (GRCm38)
  • C to T, chromosome 2 at 151,938,972 bp (GRCm38)
  • C to A, chromosome 3 at 93,395,042 bp (GRCm38)
  • T to C, chromosome 4 at 24,580,204 bp (GRCm38)
  • T to C, chromosome 4 at 140,810,532 bp (GRCm38)
  • A to G, chromosome 5 at 9,121,927 bp (GRCm38)
  • T to A, chromosome 5 at 145,702,198 bp (GRCm38)
  • T to C, chromosome 6 at 31,432,970 bp (GRCm38)
  • G to A, chromosome 6 at 35,199,974 bp (GRCm38)
  • T to G, chromosome 6 at 96,165,299 bp (GRCm38)
  • A to C, chromosome 6 at 122,736,610 bp (GRCm38)
  • T to A, chromosome 6 at 139,494,854 bp (GRCm38)
  • T to C, chromosome 7 at 29,915,259 bp (GRCm38)
  • T to C, chromosome 7 at 30,977,090 bp (GRCm38)
  • T to A, chromosome 7 at 38,520,148 bp (GRCm38)
  • T to C, chromosome 7 at 38,522,256 bp (GRCm38)
  • TGGGGACCAGCTCAGCCACGGGGACCAGCTC to TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC, chromosome 7 at 126,467,570 bp (GRCm38)
  • GGACCAGCTCAG to GGACCAGCTCAGTCACGGTGACCAGCTCAG, chromosome 7 at 126,467,573 bp (GRCm38)
  • ACCAGCTCAGCCACGGGG to ACCAGCTCAGCCACGGGGCCCAGCTCAGCCACGGGG, chromosome 7 at 126,467,575 bp (GRCm38)
  • T to C, chromosome 7 at 135,168,396 bp (GRCm38)
  • T to A, chromosome 8 at 65,014,576 bp (GRCm38)
  • C to T, chromosome 8 at 111,187,793 bp (GRCm38)
  • C to T, chromosome 9 at 13,621,673 bp (GRCm38)
  • A to G, chromosome 9 at 18,537,764 bp (GRCm38)
  • G to C, chromosome 9 at 46,270,646 bp (GRCm38)
  • C to A, chromosome 9 at 123,052,772 bp (GRCm38)
  • C to T, chromosome 10 at 22,067,941 bp (GRCm38)
  • A to G, chromosome 13 at 16,017,381 bp (GRCm38)
  • T to C, chromosome 13 at 21,133,695 bp (GRCm38)
  • G to A, chromosome 13 at 24,979,729 bp (GRCm38)
  • G to A, chromosome 13 at 59,601,003 bp (GRCm38)
  • T to A, chromosome 13 at 100,219,830 bp (GRCm38)
  • T to A, chromosome 14 at 23,543,077 bp (GRCm38)
  • A to G, chromosome 14 at 44,853,258 bp (GRCm38)
  • T to C, chromosome 14 at 49,929,449 bp (GRCm38)
  • C to G, chromosome 15 at 39,828,071 bp (GRCm38)
  • C to A, chromosome 16 at 34,875,642 bp (GRCm38)
  • T to C, chromosome 16 at 37,061,853 bp (GRCm38)
  • A to T, chromosome 17 at 54,276,641 bp (GRCm38)
  • G to A, chromosome 17 at 65,637,997 bp (GRCm38)
  • T to C, chromosome 18 at 58,066,107 bp (GRCm38)
  • C to A, chromosome 19 at 18,832,652 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9403 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069207-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.