Strain Name:
C57BL/6J-MtgxR9412Btlr/Mmmh
Stock Number:
069216-MU
Citation ID:
RRID:MMRRC_069216-MU
Other Names:
R9412 (G1)
Major Collection:

Strain Information

Tert
Name: telomerase reverse transcriptase
Synonyms: TR
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 21752
VEGA: 13
Homologene: 31141
Pcm1
Name: pericentriolar material 1
Synonyms: 9430077F19Rik, 2600002H09Rik, C030044G17Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18536
HGNC: HGNC:8727
Homologene: 4518
Igf1r
Name: insulin-like growth factor I receptor
Synonyms: CD221, IGF-1R, line 186, hyft, A330103N21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16001
HGNC: HGNC:5465
Homologene: 30997
Snapc3
Name: small nuclear RNA activating complex, polypeptide 3
Synonyms: 5031401C21Rik, 4930558A07Rik, 1810020H02Rik, E030018J20Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 77634
Homologene: 31130
Kdm5a
Name: lysine demethylase 5A
Synonyms: RBP2, Rbbp2, Jarid1a
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 214899
HGNC: HGNC:9886
Homologene: 3419
Ascc3
Name: activating signal cointegrator 1 complex subunit 3
Synonyms: ASC1p200, B630009I04Rik, Helic1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 77987
VEGA: 10
Homologene: 4973
Supt20
Name: SPT20 SAGA complex component
Synonyms: p38 interacting protein, p38IP, D3Ertd300e, Fam48a
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 56790
Homologene: 134155
Relch
Name: RAB11 binding and LisH domain, coiled-coil and HEAT repeat containing
Synonyms: 2310035C23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227446
Homologene: 10834
Tut4
Name: terminal uridylyl transferase 4
Synonyms: 6030404K05Rik, 9230115F04Rik, Tent3a, Zcchc11
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230594
Homologene: 35279
Atxn2
Name: ataxin 2
Synonyms: ATX2, 9630045M23Rik, Sca2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20239
Homologene: 2234
Uqcc1
Name: ubiquinol-cytochrome c reductase complex assembly factor 1
Synonyms: mbFZb, 3110038N19Rik, Bfzp, 2310079L17Rik, 2410003P15Rik, Uqcc, Cbp3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56046
Homologene: 14709
Ncapd3
Name: non-SMC condensin II complex, subunit D3
Synonyms: 4632407J06Rik, 2810487N22Rik, B130055D15Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 78658
VEGA: 9
Homologene: 41021
Lrrc28
Name: leucine rich repeat containing 28
Synonyms: 2310058O11Rik, 2210012C09Rik, 1300004K21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67867
Homologene: 16944
Slf2
Name: SMC5-SMC6 complex localization factor 2
Synonyms: 6030443O07Rik, Fam178a
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226151
VEGA: 19
Homologene: 23077
Zfp57
Name: zinc finger protein 57
Synonyms: G19
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22715
Homologene: 7603
Ddx21
Name: DExD box helicase 21
Synonyms: RH II/Gu, D10Ertd645e, D10Wsu42e, RH-II/Gualpha, DEAD (Asp-Glu-Ala-Asp) box polypeptide 21
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 56200
VEGA: 10
HGNC: HGNC:2744
Homologene: 3473
Med23
Name: mediator complex subunit 23
Synonyms: ESTM7, 3000002A17Rik, X83317, Crsp3, Sur2, sno
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70208
HGNC: HGNC:2372
Homologene: 3552
Ints2
Name: integrator complex subunit 2
Synonyms: 2810417D08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70422
Homologene: 10801
Fmnl2
Name: formin-like 2
Synonyms: 5430425K04Rik, man
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71409
Homologene: 70871
2700049A03Rik
Name: RIKEN cDNA 2700049A03 gene
Synonyms: talpid3, Ta3
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 76967
Homologene: 8839
Nrde2
Name: nrde-2 necessary for RNA interference, domain containing
Synonyms: 6720454P05Rik, BC002230
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217827
VEGA: 12
Homologene: 41213
Dclk3
Name: doublecortin-like kinase 3
Synonyms: Click-I, -II related, Dcamkl3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 245038
Homologene: 70580
Peg10
Name: paternally expressed 10
Synonyms: MEF3L, HB-1, MyEF-3, MyEF-3 like, Edr, Mart2, Mar2, Rtl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Lrp1
Name: low density lipoprotein receptor-related protein 1
Synonyms: CD91, A2mr, b2b1554Clo
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16971
HGNC: HGNC:6692
Homologene: 1744
Fat3
Name: FAT atypical cadherin 3
Synonyms: LOC234973, LOC382129, 9430076A06Rik, D430038H04Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270120
VEGA: 9
Homologene: 82252
Art3
Name: ADP-ribosyltransferase 3
Synonyms: 4930569O04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 109979
HGNC: HGNC:725
Homologene: 911
Unc13c
Name: unc-13 homolog C
Synonyms: Munc13-3, Unc13h3, D9Ertd414e, 1500037O19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 208898
Homologene: 45443
Ptchd3
Name: patched domain containing 3
Synonyms: 4933440L20Rik, 4930451E13Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74675
Homologene: 111041
Scap
Name: SREBF chaperone
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235623
Homologene: 8160
Abcb9
Name: ATP-binding cassette, sub-family B member 9
Synonyms: TAPL
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56325
HGNC: HGNC:50
Homologene: 10491
Zfp787
Name: zinc finger protein 787
Synonyms: 2210018M03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67109
Homologene: 18983
Abca6
Name: ATP-binding cassette, sub-family A member 6
Synonyms: 6330565N06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76184
HGNC: HGNC:36
Homologene: 71264
Serpinb9c
Name: serine (or cysteine) peptidase inhibitor, clade B, member 9c
Synonyms: 3830421J05Rik, ovalbumin, Spi11, NK9
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20707
HGNC: HGNC:8955
Pla2g4a
Name: phospholipase A2, group IVA (cytosolic, calcium-dependent)
Synonyms: cPLA2, Type IV PLA2, cytosolic PLA2, cPLA2alpha, cytosolic phospholipase A2, Pla2g4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18783
HGNC: HGNC:9035
Homologene: 32059
Flnc
Name: filamin C, gamma
Synonyms: Fln2, 1110055E19Rik, actin binding protein 280
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 68794
HGNC: HGNC:3756
Homologene: 37481
Vmn2r9
Name: vomeronasal 2, receptor 9
Synonyms: EG435864
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 435864
Homologene: 129606
Abcd4
Name: ATP-binding cassette, sub-family D member 4
Synonyms: P69r, Pxmp1l
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 19300
VEGA: 12
HGNC: HGNC:68
Homologene: 3703
Vmn2r90
Name: vomeronasal 2, receptor 90
Synonyms: EG626942
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 626942
Serpinb6c
Name: serine (or cysteine) peptidase inhibitor, clade B, member 6c
Synonyms: ovalbumin, SPIC, Spi3C
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 97848
HGNC: HGNC:8950
1700029H14Rik
Name: RIKEN cDNA 1700029H14 gene
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66501
Homologene: 41638
Or2n1d
Name: olfactory receptor family 2 subfamily N member 1D
Synonyms: GA_x6K02T2PSCP-2779375-2780313, MOR256-7, Olfr136
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258803
Homologene: 119758
Fndc1
Name: fibronectin type III domain containing 1
Synonyms: 1110027O12Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 68655
Suox
Name: sulfite oxidase
Synonyms: SO
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 211389
VEGA: 10
Homologene: 394
Arhgap45
Name: Rho GTPase activating protein 45
Synonyms: 6330406L22Rik, Hmha1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70719
Homologene: 69120
Irx5
Name: Iroquois homeobox 5
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 54352
Homologene: 38105
Scgb1b10
Name: secretoglobin, family 1B, member 10
Synonyms: Gm4384, Abpa10
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 102635992
Homologene: 114479
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to G, chromosome 1 at 105,734,563 bp (GRCm38)
  • T to C, chromosome 1 at 149,880,021 bp (GRCm38)
  • G to T, chromosome 2 at 53,117,004 bp (GRCm38)
  • A to G, chromosome 2 at 155,851,409 bp (GRCm38)
  • TCAGCAGCAGCAGCAGCAGCAGCA to TCAGCAGCAGCAGCAGCAGCA, chromosome 3 at 54,727,648 bp (GRCm38)
  • C to T, chromosome 4 at 83,436,333 bp (GRCm38)
  • A to T, chromosome 4 at 108,557,364 bp (GRCm38)
  • A to G, chromosome 5 at 92,393,154 bp (GRCm38)
  • T to A, chromosome 5 at 108,843,618 bp (GRCm38)
  • C to T, chromosome 5 at 121,802,138 bp (GRCm38)
  • C to T, chromosome 5 at 124,083,690 bp (GRCm38)
  • C to CTCT, chromosome 6 at 4,756,453 bp (GRCm38)
  • G to A, chromosome 6 at 29,441,485 bp (GRCm38)
  • A to G, chromosome 6 at 120,389,030 bp (GRCm38)
  • T to C, chromosome 7 at 6,132,947 bp (GRCm38)
  • T to A, chromosome 7 at 32,101,202 bp (GRCm38)
  • T to A, chromosome 7 at 67,531,764 bp (GRCm38)
  • T to A, chromosome 7 at 68,207,253 bp (GRCm38)
  • T to A, chromosome 8 at 13,554,695 bp (GRCm38)
  • T to G, chromosome 8 at 41,287,751 bp (GRCm38)
  • A to G, chromosome 8 at 92,359,723 bp (GRCm38)
  • T to C, chromosome 9 at 15,997,407 bp (GRCm38)
  • C to T, chromosome 9 at 27,056,155 bp (GRCm38)
  • T to C, chromosome 9 at 73,932,490 bp (GRCm38)
  • T to C, chromosome 9 at 110,378,605 bp (GRCm38)
  • G to A, chromosome 9 at 111,482,751 bp (GRCm38)
  • T to C, chromosome 10 at 24,902,121 bp (GRCm38)
  • T to C, chromosome 10 at 50,649,134 bp (GRCm38)
  • T to C, chromosome 10 at 62,594,102 bp (GRCm38)
  • CAGAGA to CAGA, chromosome 10 at 74,645,831 bp (GRCm38)
  • T to A, chromosome 10 at 80,019,730 bp (GRCm38)
  • T to A, chromosome 10 at 127,573,418 bp (GRCm38)
  • T to A, chromosome 10 at 128,671,889 bp (GRCm38)
  • T to C, chromosome 11 at 86,226,763 bp (GRCm38)
  • C to A, chromosome 11 at 110,212,233 bp (GRCm38)
  • A to T, chromosome 11 at 121,841,953 bp (GRCm38)
  • G to A, chromosome 12 at 71,188,683 bp (GRCm38)
  • T to C, chromosome 12 at 84,608,807 bp (GRCm38)
  • C to A, chromosome 12 at 100,130,422 bp (GRCm38)
  • C to A, chromosome 13 at 33,150,248 bp (GRCm38)
  • C to A, chromosome 13 at 33,897,388 bp (GRCm38)
  • C to T, chromosome 13 at 73,648,927 bp (GRCm38)
  • T to A, chromosome 17 at 7,772,366 bp (GRCm38)
  • T to G, chromosome 17 at 17,733,951 bp (GRCm38)
  • C to T, chromosome 17 at 37,009,922 bp (GRCm38)
  • A to T, chromosome 17 at 38,335,429 bp (GRCm38)
  • A to T, chromosome 19 at 44,942,021 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9412 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069216-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.