Strain Name:
C57BL/6J-MtgxR9417Btlr/Mmmh
Stock Number:
069221-MU
Citation ID:
RRID:MMRRC_069221-MU
Other Names:
R9417 (G1)
Major Collection:

Strain Information

Lamb1
Name: laminin B1
Synonyms: Lamb-1, C81607, C80098, D130003D08Rik, Lamb1-1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 16777
HGNC: HGNC:6486
Homologene: 1722
Ppp1r37
Name: protein phosphatase 1, regulatory subunit 37
Synonyms: Lrrc68
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232947
Homologene: 17851
Usp47
Name: ubiquitin specific peptidase 47
Synonyms: 4930502N04Rik, A630020C16Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74996
Homologene: 9929
Mtor
Name: mechanistic target of rapamycin kinase
Synonyms: FKBP-rapamycin-associated protein FRAP, 2610315D21Rik, RAPT1, RAFT1, flat, Frap1, mechanistic target of rapamycin (serine/threonine kinase)
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56717
HGNC: HGNC:3942
Homologene: 3637
Wwp1
Name: WW domain containing E3 ubiquitin protein ligase 1
Synonyms: SDRP1, Tiul1, AIP5, 8030445B08Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 107568
Homologene: 21385
Usp32
Name: ubiquitin specific peptidase 32
Synonyms: 6430526O11Rik, 2900074J03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237898
Homologene: 13066
Zfp462
Name: zinc finger protein 462
Synonyms: Gt4-2, 9430078C22Rik, Zfpip
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242466
Homologene: 41430
Chd4
Name: chromodomain helicase DNA binding protein 4
Synonyms: D6Ertd380e, 9530019N15Rik, Mi-2beta
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 107932
HGNC: HGNC:1919
Homologene: 68175
Ric8b
Name: RIC8 guanine nucleotide exchange factor B
Synonyms: Ric-8, Ric-8b
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237422
VEGA: 10
Homologene: 23080
Tlr2
Name: toll-like receptor 2
Synonyms: Ly105
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 24088
Homologene: 20695
Sft2d1
Name: SFT2 domain containing 1
Synonyms: 5630401J11Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106489
Homologene: 34525
Nfs1
Name: nitrogen fixation gene 1 (S. cerevisiae)
Synonyms: m-Nfs1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18041
Homologene: 5463
Syne1
Name: spectrin repeat containing, nuclear envelope 1
Synonyms: nesprin-1, SYNE-1, enaptin165, A330049M09Rik, C130039F11Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 64009
VEGA: 10
Homologene: 52329
Zranb1
Name: zinc finger, RAN-binding domain containing 1
Synonyms: D7Wsu87e, 9330160G10Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 360216
Homologene: 9728
Egfr
Name: epidermal growth factor receptor
Synonyms: avian erythroblastic leukemia viral (v-erb-b) oncogene homolog, Erbb, Wa5, 9030024J15Rik, Errb1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 13649
HGNC: HGNC:3236
Homologene: 74545
Fbl
Name: fibrillarin
Synonyms: RNU3IP1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 14113
HGNC: HGNC:3599
Homologene: 1099
Gad1
Name: glutamate decarboxylase 1
Synonyms: GAD67, Gad-1, Z49976, EP10, GAD44, GAD25
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14415
HGNC: HGNC:4092
Homologene: 635
Krr1
Name: KRR1, small subunit (SSU) processome component, homolog (yeast)
Synonyms: 2610511F02Rik, D10Ertd773e, Hrb2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 52705
HGNC: HGNC:5176
Homologene: 5114
Ankrd26
Name: ankyrin repeat domain 26
Synonyms: 5730521P14Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232339
Homologene: 45968
Ppp4r3b
Name: protein phosphatase 4 regulatory subunit 3B
Synonyms: Smek2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 104570
Homologene: 68886
Sv2b
Name: synaptic vesicle glycoprotein 2b
Synonyms: A830038F04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 64176
Homologene: 32236
Myo15a
Name: myosin XVA
Synonyms: Myo15
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17910
HGNC: HGNC:7594
Homologene: 56504
Cldn4
Name: claudin 4
Synonyms: Cpetr1, Cpetr
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12740
HGNC: HGNC:2046
Homologene: 1000
Cacna2d2
Name: calcium channel, voltage-dependent, alpha 2/delta subunit 2
Synonyms: a2d2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56808
HGNC: HGNC:1400
Homologene: 4400
Dnah2
Name: dynein, axonemal, heavy chain 2
Synonyms: D330014H01Rik, 2900022L05Rik, Dnhd3, Dnahc2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 327954
HGNC: HGNC:2948
Homologene: 72110
Ptprd
Name: protein tyrosine phosphatase receptor type D
Synonyms: 3000002J10Rik, B230219D21Rik, 1110002J03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19266
HGNC: HGNC:9668
Slc9c1
Name: solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
Synonyms: LOC208169, spermNHE, Slc9a10
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 208169
Homologene: 19505
Cdcp3
Name: CUB domain containing protein 3
Synonyms: 5430419D17Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71395
Homologene: 138430
Tmem202
Name: transmembrane protein 202
Synonyms: 4930425N13Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73893
VEGA: 9
Homologene: 52264
Gdpd4
Name: glycerophosphodiester phosphodiesterase domain containing 4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233537
Homologene: 18606
Rin2
Name: Ras and Rab interactor 2
Synonyms: RASSF4, 4632403N06Rik, 2010003K16Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74030
Homologene: 32430
Krt71
Name: keratin 71
Synonyms: mK6irs, Cu, mK6irs1, Ca, Krt2-6g, Cal4
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 56735
Homologene: 88864
Dll1
Name: delta like canonical Notch ligand 1
Synonyms: Delta1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13388
HGNC: HGNC:2908
Homologene: 4104
Rasal3
Name: RAS protein activator like 3
Synonyms: A430107D22Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 320484
Homologene: 18901
Igsf10
Name: immunoglobulin superfamily, member 10
Synonyms: 6530405F15Rik, CMF608, Adlican2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242050
Homologene: 18712
Pitrm1
Name: pitrilysin metallepetidase 1
Synonyms: 2310012C15Rik, MP-1, Ntup1, PreP
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 69617
VEGA: 13
Homologene: 5742
Fbxw10
Name: F-box and WD-40 domain protein 10
Synonyms: SM2SH2, SM25H2, Fbw10
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 213980
Homologene: 32757
Usp20
Name: ubiquitin specific peptidase 20
Synonyms: 1700055M05Rik, Vdu2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74270
Homologene: 4861
Asic1
Name: acid-sensing ion channel 1
Synonyms: BNaC2, ASIC, ASIC1a, ASICalpha, ASIC1 beta, B530003N02Rik, ASIC1b, Accn2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11419
VEGA: 15
HGNC: HGNC:100
Homologene: 121755
Ppox
Name: protoporphyrinogen oxidase
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19044
HGNC: HGNC:9280
Homologene: 262
Bean1
Name: brain expressed, associated with Nedd4, 1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 65115
Homologene: 110172
Or52s1
Name: olfactory receptor family 52 subfamily S member 1
Synonyms: GA_x6K02T2PBJ9-5927412-5928362, MOR24-2, Olfr593
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258378
Homologene: 27147
Mmp19
Name: matrix metallopeptidase 19
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 58223
VEGA: 10
HGNC: HGNC:7165
Homologene: 1820
4930553M12Rik
Name: RIKEN cDNA 4930553M12 gene
Type: Gene
Species: Mouse
Chromosome: 4
Pdzd7
Name: PDZ domain containing 7
Synonyms: Pdzk7, EG435601
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 100503041
Homologene: 129509
Isg20
Name: interferon-stimulated protein
Synonyms: DnaQl, HEM45, 2010107M23Rik, 1600023I01Rik, 20kDa
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 57444
HGNC: HGNC:6130
Homologene: 31081
Fam234a
Name: family with sequence similarity 234, member A
Synonyms: Itfg3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106581
Homologene: 12932
Ift56
Name: intraflagellar transport 56
Synonyms: hpy, hydrocephalic-polydactyl, 9430097H08Rik, hop, Ttc26
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 264134
Homologene: 11786
Elmo1
Name: engulfment and cell motility 1
Synonyms: CED-12, C230095H21Rik, 6330578D22Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 140580
Homologene: 56685
Zbtb8b
Name: zinc finger and BTB domain containing 8b
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 215627
Homologene: 65127
Hpdl
Name: 4-hydroxyphenylpyruvate dioxygenase-like
Synonyms: A830048M07Rik, Gloxd1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242642
Homologene: 13109
Skint1
Name: selection and upkeep of intraepithelial T cells 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 639781
Homologene: 87538
Gsdmc3
Name: gasdermin C3
Synonyms: 9930109F21Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 270328
HGNC: HGNC:7151
Homologene: 69487
Aldh5a1
Name: aldhehyde dehydrogenase family 5, subfamily A1
Synonyms: D630032B01Rik, OTTMUSG00000000613, 6330403E24Rik, SSADH
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 214579
HGNC: HGNC:408
Homologene: 840
Akr1b10
Name: aldo-keto reductase family 1, member B10
Synonyms: 2310005E10Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67861
Homologene: 128412
Itga7
Name: integrin alpha 7
Synonyms: [a]7, alpha7
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16404
VEGA: 10
HGNC: HGNC:6143
Homologene: 37592
Or9a4
Name: olfactory receptor family 9 subfamily A member 4
Synonyms: GA_x6K02T2P3E9-6947292-6946348, MOR120-2, Olfr460
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 258381
Homologene: 64866
Cracd
Name: capping protein inhibiting regulator of actin
Synonyms: C530008M17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320827
Homologene: 136278
Ftcd
Name: formiminotransferase cyclodeaminase
Synonyms: glutamate formiminotransferase
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14317
HGNC: HGNC:3974
Homologene: 4848
Sst
Name: somatostatin
Synonyms: SRIF, preprosomatostatin, SOM, Smst
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 20604
VEGA: 16
Homologene: 819
Yae1d1
Name: Yae1 domain containing 1
Synonyms: 1600012F09Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 67008
VEGA: 13
Homologene: 10615
Vmn2r-ps117
Name: vomeronasal 2, receptor, pseudogene 117
Synonyms: EG665303
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 665303
Pcdhga4
Name: protocadherin gamma subfamily A, 4
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93712
HGNC: HGNC:8702
Homologene: 81866
Tex35
Name: testis expressed 35
Synonyms: 1700057K13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 73435
Homologene: 49980
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to C, chromosome 1 at 157,107,219 bp (GRCm38)
  • A to G, chromosome 1 at 171,280,281 bp (GRCm38)
  • A to G, chromosome 2 at 30,983,018 bp (GRCm38)
  • A to G, chromosome 2 at 70,587,372 bp (GRCm38)
  • T to C, chromosome 2 at 145,844,793 bp (GRCm38)
  • T to A, chromosome 2 at 156,123,931 bp (GRCm38)
  • A to T, chromosome 3 at 59,329,105 bp (GRCm38)
  • T to C, chromosome 3 at 83,837,585 bp (GRCm38)
  • T to A, chromosome 4 at 19,662,215 bp (GRCm38)
  • T to C, chromosome 4 at 55,016,988 bp (GRCm38)
  • A to G, chromosome 4 at 75,947,098 bp (GRCm38)
  • A to G, chromosome 4 at 88,867,965 bp (GRCm38)
  • T to C, chromosome 4 at 112,021,312 bp (GRCm38)
  • T to C, chromosome 4 at 116,820,620 bp (GRCm38)
  • T to C, chromosome 4 at 129,432,724 bp (GRCm38)
  • T to A, chromosome 4 at 148,538,319 bp (GRCm38)
  • GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG to GCGCGAGGCCGAGAGGCAGG, chromosome 5 at 76,856,954 bp (GRCm38)
  • G to T, chromosome 5 at 134,946,320 bp (GRCm38)
  • T to C, chromosome 6 at 34,394,092 bp (GRCm38)
  • T to C, chromosome 6 at 38,409,451 bp (GRCm38)
  • T to A, chromosome 6 at 40,572,162 bp (GRCm38)
  • A to T, chromosome 6 at 118,527,764 bp (GRCm38)
  • A to G, chromosome 6 at 125,120,725 bp (GRCm38)
  • G to T, chromosome 7 at 19,535,733 bp (GRCm38)
  • G to A, chromosome 7 at 28,174,627 bp (GRCm38)
  • G to T, chromosome 7 at 75,120,024 bp (GRCm38)
  • C to T, chromosome 7 at 78,919,857 bp (GRCm38)
  • A to G, chromosome 7 at 97,957,867 bp (GRCm38)
  • A to T, chromosome 7 at 103,211,949 bp (GRCm38)
  • C to T, chromosome 7 at 112,089,594 bp (GRCm38)
  • A to G, chromosome 7 at 131,250,489 bp (GRCm38)
  • G to A, chromosome 7 at 132,983,737 bp (GRCm38)
  • CT to C, chromosome 8 at 104,182,032 bp (GRCm38)
  • A to G, chromosome 9 at 59,524,716 bp (GRCm38)
  • C to A, chromosome 9 at 107,515,490 bp (GRCm38)
  • C to T, chromosome 10 at 5,132,021 bp (GRCm38)
  • G to A, chromosome 10 at 76,581,319 bp (GRCm38)
  • A to T, chromosome 10 at 84,925,583 bp (GRCm38)
  • A to G, chromosome 10 at 111,977,121 bp (GRCm38)
  • T to A, chromosome 10 at 128,794,654 bp (GRCm38)
  • C to T, chromosome 10 at 128,957,674 bp (GRCm38)
  • T to A, chromosome 11 at 16,875,067 bp (GRCm38)
  • T to C, chromosome 11 at 29,194,598 bp (GRCm38)
  • T to A, chromosome 11 at 60,487,417 bp (GRCm38)
  • C to A, chromosome 11 at 62,862,696 bp (GRCm38)
  • T to A, chromosome 11 at 69,436,164 bp (GRCm38)
  • C to T, chromosome 11 at 84,994,543 bp (GRCm38)
  • T to A, chromosome 12 at 31,287,984 bp (GRCm38)
  • A to T, chromosome 13 at 6,567,358 bp (GRCm38)
  • A to T, chromosome 13 at 17,993,185 bp (GRCm38)
  • A to G, chromosome 13 at 20,572,403 bp (GRCm38)
  • A to T, chromosome 13 at 24,911,690 bp (GRCm38)
  • T to A, chromosome 15 at 63,866,814 bp (GRCm38)
  • A to G, chromosome 15 at 99,692,524 bp (GRCm38)
  • T to A, chromosome 15 at 101,738,296 bp (GRCm38)
  • A to G, chromosome 16 at 23,889,737 bp (GRCm38)
  • T to C, chromosome 16 at 45,593,485 bp (GRCm38)
  • T to A, chromosome 17 at 8,323,307 bp (GRCm38)
  • T to C, chromosome 17 at 15,373,448 bp (GRCm38)
  • T to A, chromosome 17 at 18,823,775 bp (GRCm38)
  • A to C, chromosome 17 at 26,216,251 bp (GRCm38)
  • A to G, chromosome 17 at 32,396,467 bp (GRCm38)
  • T to C, chromosome 18 at 37,687,507 bp (GRCm38)
  • A to G, chromosome 19 at 45,045,583 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9417 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069221-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.