Strain Name:
C57BL/6J-MtgxR9426Btlr/Mmmh
Stock Number:
069230-MU
Citation ID:
RRID:MMRRC_069230-MU
Other Names:
R9426 (G1)
Major Collection:

Strain Information

Nfib
Name: nuclear factor I/B
Synonyms: 6720429L07Rik, E030026I10Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18028
HGNC: HGNC:7785
Homologene: 4087
Nup210l
Name: nucleoporin 210-like
Synonyms: 4930548O11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 77595
Homologene: 28122
Senp2
Name: SUMO/sentrin specific peptidase 2
Synonyms: 4930538C18Rik, 2310007L05Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 75826
VEGA: 16
Homologene: 11005
Phf3
Name: PHD finger protein 3
Synonyms: 2310061N19Rik, AU020177
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 213109
HGNC: HGNC:8921
Homologene: 9040
Sec23a
Name: SEC23 homolog A, COPII coat complex component
Synonyms: Sec23r, Msec23
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20334
Homologene: 4642
Urb2
Name: URB2 ribosome biogenesis 2 homolog (S. cerevisiae)
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 382038
Homologene: 8859
Knl1
Name: kinetochore scaffold 1
Synonyms: 2310043D08Rik, 5730505K17Rik, Casc5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 76464
Homologene: 44890
R3hdm1
Name: R3H domain containing 1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226412
HGNC: HGNC:9757
Homologene: 9108
Smchd1
Name: SMC hinge domain containing 1
Synonyms: 4931400A14Rik, MommeD1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74355
Homologene: 23665
Ptbp1
Name: polypyrimidine tract binding protein 1
Synonyms: hnRNP I, Ptb
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19205
HGNC: HGNC:9583
Homologene: 49188
Strn3
Name: striatin, calmodulin binding protein 3
Synonyms: SG2NA
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 94186
VEGA: 12
Homologene: 82078
Zfp592
Name: zinc finger protein 592
Synonyms: A730014M16Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233410
Homologene: 8759
Cpne6
Name: copine VI
Synonyms: neuronal copine
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12891
HGNC: HGNC:2319
Homologene: 81815
Eif2b3
Name: eukaryotic translation initiation factor 2B, subunit 3
Synonyms: 1190002P15Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 108067
HGNC: HGNC:3259
Homologene: 7005
Scmh1
Name: sex comb on midleg homolog 1
Synonyms: Scml3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 29871
Homologene: 32146
Coq10b
Name: coenzyme Q10B
Synonyms: 1700030I21Rik, 9530077A17Rik, 1500041J02Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 67876
Homologene: 6916
Pigt
Name: phosphatidylinositol glycan anchor biosynthesis, class T
Synonyms: CGI-06, 4930534E15Rik, Ndap7, NDAP, 2510012P17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 78928
Homologene: 6134
Optn
Name: optineurin
Synonyms: 4930441O07Rik, TFIIIA-INTP
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71648
Homologene: 11085
Has3
Name: hyaluronan synthase 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 15118
HGNC: HGNC:4820
Homologene: 68461
Ttn
Name: titin
Synonyms: connectin, L56, 1100001C23Rik, mdm, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Ltbp1
Name: latent transforming growth factor beta binding protein 1
Synonyms: LTBP-1, 9430031G15Rik, b2b1000Clo, Ltbp1L
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 268977
HGNC: HGNC:6714
Homologene: 522
Stab2
Name: stabilin 2
Synonyms: STAB-2, FEEL-2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 192188
Homologene: 23022
Fhod1
Name: formin homology 2 domain containing 1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234686
Homologene: 136406
Snrk
Name: SNF related kinase
Synonyms: SNRK, 2010012F07Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20623
Homologene: 9797
Fcgbpl1
Name: Fc fragment of IgG binding protein like 1
Synonyms: 9530053A07Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 319482
Homologene: 130055
Slc4a11
Name: solute carrier family 4, sodium bicarbonate transporter-like, member 11
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269356
Homologene: 12931
Prkcg
Name: protein kinase C, gamma
Synonyms: PKCgamma, Pkcc, Prkcc
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18752
HGNC: HGNC:9402
Homologene: 20602
Dnai4
Name: dynein axonemal intermediate chain 4
Synonyms: Wdr78
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242584
Homologene: 11702
St6galnac6
Name: ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6
Synonyms: ST6GalNAcVI, Siat7f
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 50935
Homologene: 8390
Spata31h1
Name: SPATA31 subfamily H member 1
Synonyms: 4932415D10Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 102635990
VEGA: 10
Homologene: 82476
Col15a1
Name: collagen, type XV, alpha 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12819
HGNC: HGNC:2192
Homologene: 1396
Chac1
Name: ChaC, cation transport regulator 1
Synonyms: 1810008K03Rik, Botch
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69065
Homologene: 11470
Adprhl1
Name: ADP-ribosylhydrolase like 1
Synonyms: Arh2, D330008N11Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234072
Homologene: 16311
Cfap43
Name: cilia and flagella associated protein 43
Synonyms: 4930428C11Rik, 4632415N18Rik, 4930463G05Rik, D19Ertd652e, Wdr96
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 100048534
Homologene: 36425
Sult1b1
Name: sulfotransferase family 1B, member 1
Synonyms: Dopa/tyrosine sulfotransferase
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56362
Homologene: 69169
Abca7
Name: ATP-binding cassette, sub-family A member 7
Synonyms: Abc51
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 27403
HGNC: HGNC:37
Homologene: 22783
Arhgef16
Name: Rho guanine nucleotide exchange factor 16
Synonyms: Neuroblastoma
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230972
Homologene: 82484
Ces2e
Name: carboxylesterase 2E
Synonyms: 9030624L02Rik, Ces5
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234673
HGNC: HGNC:1864
Homologene: 86210
Or4d2b
Name: olfactory receptor family 4 subfamily D member 2B
Synonyms: GA_x6K02T2PAEV-9536824-9535889, MOR240-3, Olfr462
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258406
HGNC: HGNC:8294
Homologene: 64870
Hoxc10
Name: homeobox C10
Synonyms: Hox-3.6
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 209448
HGNC: HGNC:5122
Homologene: 9680
Adamts8
Name: ADAM metallopeptidase with thrombospondin type 1 motif 8
Synonyms: METH2, METH-2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 30806
HGNC: HGNC:224
Homologene: 5108
Kcnq5
Name: potassium voltage-gated channel, subfamily Q, member 5
Synonyms: 9230107O05Rik, D1Mgi1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226922
HGNC: HGNC:6299
Homologene: 28270
Spmip3
Name: sperm microtubule inner protein 3
Synonyms: 1700016C15Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 69428
Homologene: 19111
Hao1
Name: hydroxyacid oxidase 1, liver
Synonyms: GOX, Hao-1, Gox1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 15112
HGNC: HGNC:4809
Homologene: 6578
Serpina3a
Name: serine (or cysteine) peptidase inhibitor, clade A, member 3A
Synonyms: 4933406L18Rik, antitrypsin, alpha-1 antiproteinase,
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 74069
HGNC: HGNC:16
Cldnd2
Name: claudin domain containing 2
Synonyms: 1700071E18Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74276
Homologene: 17559
Tcp10c
Name: t-complex protein 10c
Synonyms: T66C-a, D17Leh66ca, D17Leh66C, Tcp-10c, Gm9880
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 100041352
VEGA: 17
Homologene: 83254
Asmt
Name: acetylserotonin O-methyltransferase
Synonyms: Hiomt
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 107626
VEGA: X
HGNC: HGNC:750
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to G, chromosome 1 at 21,402,894 bp (GRCm38)
  • A to T, chromosome 1 at 30,831,544 bp (GRCm38)
  • C to G, chromosome 1 at 55,067,560 bp (GRCm38)
  • T to C, chromosome 1 at 128,236,475 bp (GRCm38)
  • T to A, chromosome 1 at 177,743,268 bp (GRCm38)
  • T to A, chromosome 2 at 5,054,674 bp (GRCm38)
  • T to C, chromosome 2 at 32,615,082 bp (GRCm38)
  • C to T, chromosome 2 at 76,885,013 bp (GRCm38)
  • C to T, chromosome 2 at 119,069,498 bp (GRCm38)
  • T to A, chromosome 2 at 119,353,433 bp (GRCm38)
  • C to T, chromosome 2 at 130,691,744 bp (GRCm38)
  • T to A, chromosome 2 at 134,505,635 bp (GRCm38)
  • CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT to CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT, chromosome 2 at 164,499,669 bp (GRCm38)
  • C to T, chromosome 3 at 90,199,866 bp (GRCm38)
  • G to C, chromosome 4 at 47,288,200 bp (GRCm38)
  • T to G, chromosome 4 at 82,498,292 bp (GRCm38)
  • A to T, chromosome 4 at 103,049,546 bp (GRCm38)
  • C to A, chromosome 4 at 117,066,381 bp (GRCm38)
  • T to C, chromosome 4 at 120,505,359 bp (GRCm38)
  • A to C, chromosome 4 at 154,281,843 bp (GRCm38)
  • T to A, chromosome 5 at 87,517,421 bp (GRCm38)
  • G to T, chromosome 5 at 94,303,142 bp (GRCm38)
  • C to T, chromosome 7 at 3,327,459 bp (GRCm38)
  • A to T, chromosome 7 at 28,143,856 bp (GRCm38)
  • A to T, chromosome 7 at 43,443,264 bp (GRCm38)
  • A to T, chromosome 7 at 81,024,457 bp (GRCm38)
  • A to G, chromosome 8 at 13,224,034 bp (GRCm38)
  • A to G, chromosome 8 at 104,929,588 bp (GRCm38)
  • C to T, chromosome 8 at 105,329,858 bp (GRCm38)
  • A to G, chromosome 8 at 106,874,191 bp (GRCm38)
  • T to G, chromosome 8 at 124,028,546 bp (GRCm38)
  • A to G, chromosome 9 at 30,953,425 bp (GRCm38)
  • T to A, chromosome 9 at 122,157,260 bp (GRCm38)
  • T to A, chromosome 10 at 79,859,063 bp (GRCm38)
  • A to G, chromosome 10 at 80,015,430 bp (GRCm38)
  • T to A, chromosome 10 at 82,290,776 bp (GRCm38)
  • T to C, chromosome 10 at 86,869,047 bp (GRCm38)
  • A to T, chromosome 11 at 87,889,230 bp (GRCm38)
  • T to C, chromosome 12 at 51,648,090 bp (GRCm38)
  • A to G, chromosome 12 at 59,007,104 bp (GRCm38)
  • A to G, chromosome 12 at 104,121,390 bp (GRCm38)
  • T to C, chromosome 14 at 55,513,719 bp (GRCm38)
  • A to T, chromosome 15 at 102,970,854 bp (GRCm38)
  • A to G, chromosome 16 at 22,009,741 bp (GRCm38)
  • T to C, chromosome 17 at 13,364,201 bp (GRCm38)
  • C to T, chromosome 17 at 71,365,130 bp (GRCm38)
  • C to T, chromosome 17 at 75,291,314 bp (GRCm38)
  • A to G, chromosome 19 at 47,825,798 bp (GRCm38)
  • G to A, chromosome X at 170,676,464 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9426 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069230-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.