Strain Name:
C57BL/6J-MtgxR9449Btlr/Mmmh
Stock Number:
069252-MU
Citation ID:
RRID:MMRRC_069252-MU
Other Names:
R9449 (G1)
Major Collection:

Strain Information

Slc12a1
Name: solute carrier family 12, member 1
Synonyms: Nkcc2, mBSC1, D630042G03Rik, urehr3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20495
Homologene: 286
Slc32a1
Name: solute carrier family 32 (GABA vesicular transporter), member 1
Synonyms: R75019, VGAT, Viaat
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22348
Homologene: 56451
Manba
Name: mannosidase, beta A, lysosomal
Synonyms: Bmn, 2410030O07Rik, B930014J03Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 110173
HGNC: HGNC:6831
Homologene: 4317
Nr4a1
Name: nuclear receptor subfamily 4, group A, member 1
Synonyms: Nur77, TIS1, TR3, N10, NP10, GFRP1, NGFI-B, Hbr-1, Gfrp, Hbr1, Hmr
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 15370
VEGA: 15
HGNC: HGNC:7980
Homologene: 1612
Slc44a2
Name: solute carrier family 44, member 2
Synonyms: 1110028E10Rik, CTL2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 68682
VEGA: 9
Homologene: 10711
Plxnd1
Name: plexin D1
Synonyms: 6230425C21Rik, b2b553Clo, b2b1863Clo
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67784
HGNC: HGNC:9107
Homologene: 22866
Itsn1
Name: intersectin 1 (SH3 domain protein 1A)
Synonyms: Ese1, EHSH1, Sh3p17, Eh domain, SH3 domain regulator of endocytosis 1, Intersectin-L
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 16443
HGNC: HGNC:6183
Homologene: 2277
Abhd17c
Name: abhydrolase domain containing 17C
Synonyms: 2210412D01Rik, Fam108c
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 70178
Homologene: 26429
Arhgap21
Name: Rho GTPase activating protein 21
Synonyms: 5530401C11Rik, ARHGAP10
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71435
Homologene: 10822
Rock2
Name: Rho-associated coiled-coil containing protein kinase 2
Synonyms: Rock-II, B230113H15Rik, Rho-kinase, ROKalpha, Rock2m
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 19878
VEGA: 12
Homologene: 21010
Chd9
Name: chromodomain helicase DNA binding protein 9
Synonyms: 1810014J18Rik, AD013, A330063D19Rik, 9030205D12Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 109151
Homologene: 11844
Vti1a
Name: vesicle transport through interaction with t-SNAREs 1A
Synonyms: Vti1-rp2, 1110018K19Rik, 1110014F16Rik, 4921537J05Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 53611
VEGA: 19
Homologene: 39963
Npas4
Name: neuronal PAS domain protein 4
Synonyms: LE-PAS, Nxf, Npas4
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225872
VEGA: 19
Homologene: 15333
Limk1
Name: LIM domain kinase 1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 16885
HGNC: HGNC:6613
Homologene: 1738
Ermard
Name: ER membrane associated RNA degradation
Synonyms: 2410011O22Rik, 2210404J11Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 381062
Homologene: 19936
Aarsd1
Name: alanyl-tRNA synthetase domain containing 1
Synonyms: 2310044P18Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69684
Homologene: 6821
Numbl
Name: numb-like
Synonyms: nbl
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18223
HGNC: HGNC:8061
Homologene: 68413
Adam33
Name: a disintegrin and metallopeptidase domain 33
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 110751
Homologene: 11881
Clec1a
Name: C-type lectin domain family 1, member a
Synonyms: 5930406N14Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243653
Homologene: 9549
Cthrc1
Name: collagen triple helix repeat containing 1
Synonyms: 1110014B07Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 68588
Homologene: 16320
Tm7sf3
Name: transmembrane 7 superfamily member 3
Synonyms: 2010003B14Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67623
Homologene: 9560
Eml5
Name: echinoderm microtubule associated protein like 5
Synonyms: C130068M19Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319670
VEGA: 12
Homologene: 26807
Znrf3
Name: zinc and ring finger 3
Synonyms: LOC382477
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 407821
Homologene: 46592
Galnt12
Name: polypeptide N-acetylgalactosaminyltransferase 12
Synonyms: A630062B03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230145
Homologene: 11637
Ppil3
Name: peptidylprolyl isomerase (cyclophilin)-like 3
Synonyms: 2510026K04Rik, Cyp10l, 2310076N22Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 70225
HGNC: HGNC:9262
Homologene: 41717
Myh6
Name: myosin, heavy polypeptide 6, cardiac muscle, alpha
Synonyms: alpha myosin, Myhc-a, alpha cardiac MHC, cardiomyopathy, hypertrophic 1, Myhca, A830009F23Rik, alpha-MHC, alphaMHC
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 17888
HGNC: HGNC:7576
Homologene: 124414
Bcat2
Name: branched chain aminotransferase 2, mitochondrial
Synonyms: Eca40, Bcat-2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12036
HGNC: HGNC:977
Homologene: 81684
Dnah17
Name: dynein, axonemal, heavy chain 17
Synonyms: LOC382552, 2810003K23Rik, Dnahcl1, Dnahc17
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69926
HGNC: HGNC:2946
Homologene: 72102
Zfyve9
Name: zinc finger, FYVE domain containing 9
Synonyms: Madhip
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230597
HGNC: HGNC:6775
Homologene: 3527
Dnah3
Name: dynein, axonemal, heavy chain 3
Synonyms: Dnahc3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381917
HGNC: HGNC:2949
Homologene: 19674
Vmn2r116
Name: vomeronasal 2, receptor 116
Synonyms: EG619697, V2Rp5
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 619697
Homologene: 86604
Usp50
Name: ubiquitin specific peptidase 50
Synonyms: 1700086G18Rik, 4930511O11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75083
Homologene: 75281
Psd3
Name: pleckstrin and Sec7 domain containing 3
Synonyms: 4931420C21Rik, EFA6D
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234353
Homologene: 87257
Psme2b
Name: protease (prosome, macropain) activator subunit 2B
Synonyms: Psme2-like, PA28b2, Psme2b, Psme2b-ps
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 621823
HGNC: HGNC:9569
Igsf3
Name: immunoglobulin superfamily, member 3
Synonyms: 4833439O17Rik, 2810035F16Rik, 1700016K10Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 78908
HGNC: HGNC:5950
Homologene: 1182
Alpk2
Name: alpha-kinase 2
Synonyms: Hak
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225638
Homologene: 50475
Pla2r1
Name: phospholipase A2 receptor 1
Synonyms: PLA2-I receptor, M-type receptor, Pla2g1br
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18779
HGNC: HGNC:9042
Homologene: 32016
Cps1
Name: carbamoyl-phosphate synthetase 1
Synonyms: CPS, CPSase I, 4732433M03Rik, D1Ucla3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227231
HGNC: HGNC:2323
Homologene: 68208
Parp9
Name: poly (ADP-ribose) polymerase family, member 9
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 80285
Homologene: 12720
Kcna2
Name: potassium voltage-gated channel, shaker-related subfamily, member 2
Synonyms: Kv1.2, Kca1-2, Mk-2, Akr6a4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 16490
HGNC: HGNC:6220
Homologene: 21034
Dennd3
Name: DENN domain containing 3
Synonyms: E030003N15Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105841
Homologene: 28254
Per3
Name: period circadian clock 3
Synonyms: mPer3, 2810049O06Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18628
HGNC: HGNC:8847
Homologene: 7886
Simc1
Name: SUMO-interacting motifs containing 1
Synonyms: 4732471D19Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 319719
Homologene: 131217
Ssbp2
Name: single-stranded DNA binding protein 2
Synonyms: Hspc116, 2310079I02Rik, 9330163K02Rik, 1500004K09Rik, A830008M03Rik, Ssdp2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 66970
Homologene: 22724
Ric8a
Name: RIC8 guanine nucleotide exchange factor A
Synonyms: RIC-8, synembryn, Ric8
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101489
Homologene: 23331
Stat5b
Name: signal transducer and activator of transcription 5B
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20851
Homologene: 55718
Gpr161
Name: G protein-coupled receptor 161
Synonyms: LOC240888, vl
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240888
Homologene: 17824
Or10x4
Name: olfactory receptor family 10 subfamily X member 4
Synonyms: GA_x6K02T2P20D-20771141-20770212, GA_x6K02T2MFC0-1145-1312, MOR267-7, Olfr415, Olfr248
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 258709
Or5p4
Name: olfactory receptor family 5 subfamily P member 4
Synonyms: GA_x6K02T2PBJ9-10409785-10410723, MOR204-2, MOR204-39, Olfr481
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258927
Homologene: 105166
Cdh10
Name: cadherin 10
Synonyms: T2-cadherin, A830016G23Rik, C030003B10Rik, C030011H18Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 320873
HGNC: HGNC:1749
Homologene: 68530
Haus6
Name: HAUS augmin-like complex, subunit 6
Synonyms: D4Ertd27e, 6230416J20Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230376
Homologene: 9760
Vmn1r40
Name: vomeronasal 1 receptor 40
Synonyms: V1rb7
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 113855
Homologene: 113975
Pdia2
Name: protein disulfide isomerase associated 2
Synonyms: 1810041F13Rik, Pdipl, Pdip
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 69191
Homologene: 55994
Gabrd
Name: gamma-aminobutyric acid (GABA) A receptor, subunit delta
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14403
HGNC: HGNC:4084
Homologene: 55489
Ctsm
Name: cathepsin M
Synonyms: Cat M, Catm, 1600027J17Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 64139
VEGA: 13
Homologene: 75181
Vegfc
Name: vascular endothelial growth factor C
Synonyms: VEGF-C
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 22341
Homologene: 3962
Dram1
Name: DNA-damage regulated autophagy modulator 1
Synonyms: 1200002N14Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71712
Homologene: 41255
2200002D01Rik
Name: RIKEN cDNA 2200002D01 gene
Synonyms: H2RSP, HAI-2 related small protein
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72275
Homologene: 137385
Pole3
Name: polymerase (DNA directed), epsilon 3 (p17 subunit)
Synonyms: YBL1, 1810034K18Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 59001
Homologene: 9694
Fam181a
Name: family with sequence similarity 181, member A
Synonyms: EG544888
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 100504156
Homologene: 34701
Pcdha11
Name: protocadherin alpha 11
Synonyms: Cnr7, Crnr7, A830022B16Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 12942
HGNC: HGNC:8665
Homologene: 75095
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to C, chromosome 1 at 58,431,238 bp (GRCm38)
  • T to C, chromosome 1 at 67,220,512 bp (GRCm38)
  • A to T, chromosome 1 at 165,318,820 bp (GRCm38)
  • G to A, chromosome 1 at 174,391,176 bp (GRCm38)
  • A to G, chromosome 2 at 20,880,653 bp (GRCm38)
  • A to T, chromosome 2 at 60,428,558 bp (GRCm38)
  • T to A, chromosome 2 at 125,186,224 bp (GRCm38)
  • A to G, chromosome 2 at 126,777,897 bp (GRCm38)
  • T to C, chromosome 2 at 131,053,686 bp (GRCm38)
  • T to C, chromosome 2 at 158,614,321 bp (GRCm38)
  • T to A, chromosome 3 at 101,451,006 bp (GRCm38)
  • T to A, chromosome 3 at 107,105,571 bp (GRCm38)
  • A to T, chromosome 3 at 135,549,318 bp (GRCm38)
  • T to A, chromosome 4 at 47,104,163 bp (GRCm38)
  • A to T, chromosome 4 at 62,524,040 bp (GRCm38)
  • A to T, chromosome 4 at 86,595,428 bp (GRCm38)
  • C to A, chromosome 4 at 108,719,238 bp (GRCm38)
  • G to A, chromosome 4 at 151,010,488 bp (GRCm38)
  • C to A, chromosome 4 at 155,388,346 bp (GRCm38)
  • A to G, chromosome 5 at 134,673,010 bp (GRCm38)
  • A to G, chromosome 6 at 89,714,872 bp (GRCm38)
  • T to A, chromosome 6 at 115,955,769 bp (GRCm38)
  • T to C, chromosome 6 at 129,451,643 bp (GRCm38)
  • C to T, chromosome 6 at 146,623,681 bp (GRCm38)
  • C to T, chromosome 7 at 27,276,902 bp (GRCm38)
  • CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC to CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC, chromosome 7 at 29,247,623 bp (GRCm38)
  • T to C, chromosome 7 at 45,585,556 bp (GRCm38)
  • A to G, chromosome 7 at 84,114,429 bp (GRCm38)
  • T to C, chromosome 7 at 108,080,833 bp (GRCm38)
  • T to A, chromosome 7 at 119,952,250 bp (GRCm38)
  • C to G, chromosome 7 at 140,857,480 bp (GRCm38)
  • A to T, chromosome 8 at 54,157,018 bp (GRCm38)
  • A to T, chromosome 8 at 67,713,181 bp (GRCm38)
  • T to C, chromosome 8 at 90,932,546 bp (GRCm38)
  • A to G, chromosome 9 at 21,347,037 bp (GRCm38)
  • C to T, chromosome 10 at 88,356,841 bp (GRCm38)
  • A to T, chromosome 11 at 5,338,710 bp (GRCm38)
  • T to G, chromosome 11 at 48,945,739 bp (GRCm38)
  • T to C, chromosome 11 at 100,790,848 bp (GRCm38)
  • A to C, chromosome 11 at 101,410,771 bp (GRCm38)
  • A to G, chromosome 11 at 118,096,626 bp (GRCm38)
  • A to T, chromosome 12 at 16,977,762 bp (GRCm38)
  • A to G, chromosome 12 at 98,861,295 bp (GRCm38)
  • A to G, chromosome 12 at 103,315,848 bp (GRCm38)
  • A to G, chromosome 13 at 54,526,379 bp (GRCm38)
  • A to T, chromosome 13 at 61,538,485 bp (GRCm38)
  • A to G, chromosome 13 at 91,675,038 bp (GRCm38)
  • A to T, chromosome 14 at 54,952,322 bp (GRCm38)
  • A to G, chromosome 15 at 19,013,435 bp (GRCm38)
  • A to G, chromosome 15 at 39,084,473 bp (GRCm38)
  • A to T, chromosome 15 at 73,557,628 bp (GRCm38)
  • T to C, chromosome 15 at 101,270,172 bp (GRCm38)
  • T to C, chromosome 16 at 35,956,864 bp (GRCm38)
  • T to A, chromosome 16 at 91,828,376 bp (GRCm38)
  • C to T, chromosome 17 at 15,053,292 bp (GRCm38)
  • A to G, chromosome 17 at 23,386,945 bp (GRCm38)
  • T to C, chromosome 17 at 26,197,200 bp (GRCm38)
  • A to G, chromosome 18 at 37,012,431 bp (GRCm38)
  • G to A, chromosome 18 at 65,291,393 bp (GRCm38)
  • T to A, chromosome 19 at 4,988,464 bp (GRCm38)
  • T to A, chromosome 19 at 55,623,846 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9449 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069252-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.