Strain Name:
C57BL/6J-MtgxR9465Btlr/Mmmh
Stock Number:
069268-MU
Citation ID:
RRID:MMRRC_069268-MU
Other Names:
R9465 (G1)
Major Collection:

Strain Information

Cadps
Name: Ca2+-dependent secretion activator
Synonyms: CAPS1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 27062
VEGA: 14
HGNC: HGNC:1426
Homologene: 2755
Med1
Name: mediator complex subunit 1
Synonyms: TRAP 220, TRAP220, CRSP210, DRIP205, Pparbp, l11Jus15, PBP
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19014
HGNC: HGNC:9234
Homologene: 21002
Spred1
Name: sprouty protein with EVH-1 domain 1, related sequence
Synonyms: Spred-1, 5730461F13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 114715
Homologene: 24919
Mtor
Name: mechanistic target of rapamycin kinase
Synonyms: FKBP-rapamycin-associated protein FRAP, 2610315D21Rik, RAPT1, RAFT1, flat, Frap1, mechanistic target of rapamycin (serine/threonine kinase)
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56717
HGNC: HGNC:3942
Homologene: 3637
Phkb
Name: phosphorylase kinase beta
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 102093
HGNC: HGNC:8927
Homologene: 247
Ptbp1
Name: polypyrimidine tract binding protein 1
Synonyms: hnRNP I, Ptb
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19205
HGNC: HGNC:9583
Homologene: 49188
Tomm22
Name: translocase of outer mitochondrial membrane 22
Synonyms: Tom22
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223696
Homologene: 10638
Arih2
Name: ariadne RBR E3 ubiquitin protein ligase 2
Synonyms: TRIAD1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 23807
HGNC: HGNC:690
Homologene: 48424
Gigyf2
Name: GRB10 interacting GYF protein 2
Synonyms: A830080H02Rik, 2610016F01Rik, Tnrc15
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227331
Homologene: 41048
Creb3l1
Name: cAMP responsive element binding protein 3-like 1
Synonyms: BBF-2 (drosophila) homolog, Oasis
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 26427
Homologene: 8058
Dnah8
Name: dynein, axonemal, heavy chain 8
Synonyms: Hst6.7b, P1-Loop, Dnahc8
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13417
VEGA: 17
HGNC: HGNC:2952
Homologene: 1049
Atg4a-ps
Name: autophagy related 4A, pseudogene
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 102926
Dennd5b
Name: DENN domain containing 5B
Synonyms: 9330160C06Rik, D030011O10Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 320560
Homologene: 44911
Ttn
Name: titin
Synonyms: connectin, L56, 1100001C23Rik, mdm, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Spata31
Name: spermatogenesis associated 31
Synonyms: Spata31a, Fam75a, 4930458L03Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 78124
Homologene: 84621
Tgm5
Name: transglutaminase 5
Synonyms: 2310007C07Rik, TGx
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74176
Homologene: 20899
Gstm3
Name: glutathione S-transferase, mu 3
Synonyms: mGSTM5, Fsc2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14864
HGNC: HGNC:4632
Homologene: 37356
Helz2
Name: helicase with zinc finger 2, transcriptional coactivator
Synonyms: BC006779
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 229003
Homologene: 14118
Dlgap2
Name: DLG associated protein 2
Synonyms: SAP90/PSD-95-associated protein 2, PSD-95/SAP90-binding protein 2, 6430596N04Rik, DAP2, Sapap2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244310
HGNC: HGNC:2906
Homologene: 3484
Otog
Name: otogelin
Synonyms: Otgn
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18419
HGNC: HGNC:8516
Homologene: 8421
Wdr64
Name: WD repeat domain 64
Synonyms: 4930415O10Rik, 4930511H01Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 75820
Homologene: 51634
Perm1
Name: PPARGC1 and ESRR induced regulator, muscle 1
Synonyms: 2310042D19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74183
Homologene: 135954
Or1j14
Name: olfactory receptor family 1 subfamily J member 14
Synonyms: GA_x6K02T2NLDC-33222024-33222962, MOR136-4, Olfr342
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258950
Homologene: 74223
4933427I04Rik
Name: Riken cDNA 4933427I04 gene
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 115489902
VEGA: 4
Cyp2j5
Name: cytochrome P450, family 2, subfamily j, polypeptide 5
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13109
HGNC: HGNC:2634
Homologene: 116530
Ninl
Name: ninein-like
Synonyms: LOC381388, LOC381387, 4930519N13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 78177
Homologene: 57024
Tmprss11f
Name: transmembrane protease, serine 11f
Synonyms: 4732406D01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243083
Homologene: 65356
Il18rap
Name: interleukin 18 receptor accessory protein
Synonyms: AcPL accessory protein-like)
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16174
HGNC: HGNC:5989
Homologene: 2859
Prl2c5
Name: prolactin family 2, subfamily c, member 5
Synonyms: MRP-4, PLF-4, Mrpplf4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 107849
Homologene: 40763
Kcnh1
Name: potassium voltage-gated channel, subfamily H (eag-related), member 1
Synonyms: ether a go-go, Eag1, Kv10.1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16510
HGNC: HGNC:6250
Homologene: 68242
Adcy7
Name: adenylate cyclase 7
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11513
HGNC: HGNC:238
Homologene: 866
Il24
Name: interleukin 24
Synonyms: Mda-7, FISP
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 93672
Homologene: 4991
Repin1
Name: replication initiator 1
Synonyms: Zfp464, AP4, E430037F08Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 58887
Homologene: 22810
Zswim2
Name: zinc finger SWIM-type containing 2
Synonyms: 1700025P14Rik, 4933437F18Rik, MEX
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71861
Homologene: 32689
Marveld3
Name: MARVEL (membrane-associating) domain containing 3
Synonyms: MARVD3, 1810006A16Rik, Mrvldc3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 73608
Homologene: 12504
Or6aa1
Name: olfactory receptor family 6 subfamily AA member 1
Synonyms: GA_x6K02T2NHDJ-9712819-9713778, MOR104-2, Olfr303
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258612
Homologene: 105157
Btd
Name: biotinidase
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 26363
HGNC: HGNC:1122
Homologene: 37255
Scrn1
Name: secernin 1
Synonyms: 6330535A03Rik, SES1, 2810019K23Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 69938
Homologene: 8853
Hipk4
Name: homeodomain interacting protein kinase 4
Synonyms: LOC233020
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233020
Homologene: 16970
Taar7e
Name: trace amine-associated receptor 7E
Synonyms: LOC276742
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 276742
Homologene: 134040
Ppp2r3d
Name: protein phosphatase 2 (formerly 2A), regulatory subunit B'', delta
Synonyms: PR59, Ppp2r3, Ppp2r3a
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19054
Krtap4-2
Name: keratin associated protein 4-2
Synonyms: 1110033F04Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68673
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • C to T, chromosome 1 at 40,543,017 bp (GRCm38)
  • A to G, chromosome 1 at 87,407,053 bp (GRCm38)
  • T to C, chromosome 1 at 130,885,725 bp (GRCm38)
  • A to G, chromosome 1 at 175,791,257 bp (GRCm38)
  • G to A, chromosome 1 at 192,241,925 bp (GRCm38)
  • T to C, chromosome 2 at 36,527,886 bp (GRCm38)
  • C to A, chromosome 2 at 76,747,187 bp (GRCm38)
  • C to T, chromosome 2 at 83,915,931 bp (GRCm38)
  • C to T, chromosome 2 at 91,991,886 bp (GRCm38)
  • G to A, chromosome 2 at 117,153,167 bp (GRCm38)
  • T to A, chromosome 2 at 121,075,152 bp (GRCm38)
  • A to G, chromosome 2 at 150,940,806 bp (GRCm38)
  • G to T, chromosome 2 at 181,232,917 bp (GRCm38)
  • C to T, chromosome 3 at 103,645,785 bp (GRCm38)
  • T to C, chromosome 3 at 107,966,115 bp (GRCm38)
  • T to C, chromosome 4 at 96,634,314 bp (GRCm38)
  • A to C, chromosome 4 at 123,860,524 bp (GRCm38)
  • T to A, chromosome 4 at 148,540,382 bp (GRCm38)
  • TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT to TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT, chromosome 4 at 156,218,068 bp (GRCm38)
  • T to C, chromosome 5 at 86,538,017 bp (GRCm38)
  • A to G, chromosome 6 at 48,594,943 bp (GRCm38)
  • A to T, chromosome 6 at 54,525,664 bp (GRCm38)
  • A to G, chromosome 6 at 149,006,762 bp (GRCm38)
  • T to A, chromosome 7 at 27,529,735 bp (GRCm38)
  • T to C, chromosome 7 at 46,305,875 bp (GRCm38)
  • T to C, chromosome 7 at 86,394,656 bp (GRCm38)
  • G to A, chromosome 8 at 14,778,226 bp (GRCm38)
  • G to A, chromosome 8 at 85,896,430 bp (GRCm38)
  • G to T, chromosome 8 at 88,320,150 bp (GRCm38)
  • T to A, chromosome 8 at 109,961,893 bp (GRCm38)
  • C to G, chromosome 9 at 108,611,739 bp (GRCm38)
  • A to G, chromosome 9 at 124,442,222 bp (GRCm38)
  • A to G, chromosome 10 at 24,038,412 bp (GRCm38)
  • T to C, chromosome 10 at 79,859,781 bp (GRCm38)
  • T to C, chromosome 11 at 98,158,318 bp (GRCm38)
  • A to G, chromosome 11 at 99,634,565 bp (GRCm38)
  • C to T, chromosome 13 at 13,185,946 bp (GRCm38)
  • T to A, chromosome 13 at 64,920,713 bp (GRCm38)
  • A to G, chromosome 14 at 12,489,002 bp (GRCm38)
  • G to A, chromosome 14 at 31,667,686 bp (GRCm38)
  • T to C, chromosome 15 at 79,671,267 bp (GRCm38)
  • CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT to CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT, chromosome 17 at 30,760,867 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9465 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069268-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.