Strain Name:
C57BL/6J-MtgxR9482Btlr/Mmmh
Stock Number:
069285-MU
Citation ID:
RRID:MMRRC_069285-MU
Other Names:
R9482 (G1)
Major Collection:

Strain Information

Nucks1
Name: nuclear casein kinase and cyclin-dependent kinase substrate 1
Synonyms: Nucks, 2700010L10Rik, 8430423A01Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98415
Homologene: 23377
Pik3c2a
Name: phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha
Synonyms: PI3KC2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18704
HGNC: HGNC:8971
Homologene: 20581
Rbm6
Name: RNA binding motif protein 6
Synonyms: NY-LU-12, g16, Def-3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19654
HGNC: HGNC:9903
Homologene: 31336
Zfat
Name: zinc finger and AT hook domain containing
Synonyms: LOC380993, Zfp406, Zfat1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 380993
Homologene: 16829
Nedd4l
Name: neural precursor cell expressed, developmentally down-regulated gene 4-like
Synonyms: Nedd4-2, 1300012C07Rik, Nedd4b
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 83814
VEGA: 18
HGNC: HGNC:7728
Homologene: 86986
Als2
Name: alsin Rho guanine nucleotide exchange factor
Synonyms: 3222402C23Rik, Als2cr6, 9430073A21Rik, Alsin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74018
HGNC: HGNC:443
Homologene: 23264
Mycbp
Name: MYC binding protein
Synonyms: Amy-1, 5730488M09Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56309
HGNC: HGNC:7554
Homologene: 49312
C2cd2l
Name: C2 calcium-dependent domain containing 2-like
Synonyms: 1300006O23Rik, Tmem24
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71764
VEGA: 9
Homologene: 8876
Trmt6
Name: tRNA methyltransferase 6
Synonyms: 3300001M20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66926
Homologene: 6816
Hjurp
Name: Holliday junction recognition protein
Synonyms: C330011F01Rik, A730008H23Rik, 6430706D22Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381280
Homologene: 10184
Nbeal2
Name: neurobeachin-like 2
Synonyms: 1110014F23Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235627
Homologene: 86422
Angptl7
Name: angiopoietin-like 7
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 654812
Homologene: 133923
Flrt3
Name: fibronectin leucine rich transmembrane protein 3
Synonyms: 5530600M07Rik, C430047I10Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71436
HGNC: HGNC:3762
Homologene: 8322
Rb1
Name: RB transcriptional corepressor 1
Synonyms: pRb, Rb, Rb-1, retinoblastoma 1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 19645
HGNC: HGNC:9884
Homologene: 272
Serf2
Name: small EDRK-rich factor 2
Synonyms: 4F5rel (4F5 related), m4F5rel
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 378702
Homologene: 85994
Knop1
Name: lysine rich nucleolar protein 1
Synonyms: Tsg118, 2310008H09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66356
Homologene: 49729
Sympk
Name: symplekin
Synonyms: 4632415H16Rik, 1500016F02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 68188
Homologene: 37969
Zfyve26
Name: zinc finger, FYVE domain containing 26
Synonyms: 9330197E15Rik, LOC380767, A630028O16Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 211978
VEGA: 12
Homologene: 9102
Emc1
Name: ER membrane protein complex subunit 1
Synonyms: C230096C10Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230866
Homologene: 9002
Kcnk2
Name: potassium channel, subfamily K, member 2
Synonyms: TREK-1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16526
HGNC: HGNC:6277
Homologene: 7794
Chst10
Name: carbohydrate sulfotransferase 10
Synonyms: ST, Hnk-1st
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98388
Homologene: 21013
Tab2
Name: TGF-beta activated kinase 1/MAP3K7 binding protein 2
Synonyms: Tak1 binding protein 2, 1110030N06Rik, A530078N03Rik, Map3k7ip2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 68652
Homologene: 9019
Hmcn1
Name: hemicentin 1
Synonyms: LOC240793, EG545370
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 545370
Homologene: 23741
Rasef
Name: RAS and EF hand domain containing
Synonyms: RAB45
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242505
Homologene: 28424
Gen1
Name: GEN1, Holliday junction 5' flap endonuclease
Synonyms: 5830483C08Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 209334
VEGA: 12
Homologene: 35313
Prss52
Name: serine protease 52
Synonyms: 1700049K14Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 73382
Homologene: 105740
Myh1
Name: myosin, heavy polypeptide 1, skeletal muscle, adult
Synonyms: MyHC-IId/x, Myhs-f2, Myhs-f, Myhsf2, A530084A17Rik, MYHC-IIX, myosin heavy chain 2X, IId, IId/x
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17879
HGNC: HGNC:7567
Homologene: 133718
Or4a72
Name: olfactory receptor family 4 subfamily A member 72
Synonyms: GA_x6K02T2Q125-51020951-51020028, MOR231-12, Olfr1245
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258784
Homologene: 121560
Kcnma1
Name: potassium large conductance calcium-activated channel, subfamily M, alpha member 1
Synonyms: Slo, mSlo1, Slo1, MaxiK, BK channel alpha subunit, 5730414M22Rik, BKCa
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 16531
HGNC: HGNC:6284
Homologene: 1693
Jsrp1
Name: junctional sarcoplasmic reticulum protein 1
Synonyms: JP-45, 2310032K21Rik, 2300003C06Rik, JP45
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71912
Homologene: 12422
Kmt2d
Name: lysine (K)-specific methyltransferase 2D
Synonyms: C430014K11Rik, Mll4, Mll2, bapa
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 381022
HGNC: HGNC:7133
Homologene: 86893
Lpin3
Name: lipin 3
Synonyms: 9130206L11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 64899
Homologene: 84844
Nup210
Name: nucleoporin 210
Synonyms: gp210, gp190, Pom210
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 54563
Homologene: 41286
Fcrla
Name: Fc receptor-like A
Synonyms: FCRL1, FREB, Fcrx, Freb1, mFREB, mFcrX
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98752
Homologene: 13106
Sh2b1
Name: SH2B adaptor protein 1
Synonyms: Irip, SH2-Bb, SH2-B, Sh2bpsm1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20399
Homologene: 32122
Tnk1
Name: tyrosine kinase, non-receptor, 1
Synonyms: Kos1, Tnk1b, Tnk1a
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 83813
Homologene: 2966
Adgrg6
Name: adhesion G protein-coupled receptor G6
Synonyms: LOC215798, 1190004A11Rik, DREG, Gpr126
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215798
Homologene: 10724
Zfp1004
Name: zinc finger protein 1004
Synonyms: Gm14139
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 100271882
Homologene: 134546
Irag1
Name: inositol 1,4,5-triphosphate receptor associated 1
Synonyms: Ris1, Mrvi1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17540
HGNC: HGNC:7237
Homologene: 4425
Selplg
Name: selectin, platelet (p-selectin) ligand
Synonyms: Psgl-1, Psgl1, CD162
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20345
Homologene: 2261
Pcdhb3
Name: protocadherin beta 3
Synonyms: PcdhbC
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93874
HGNC: HGNC:8688
Homologene: 115665
Crocc2
Name: ciliary rootlet coiled-coil, rootletin family member 2
Synonyms: LOC381284, E030010N08Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381284
Homologene: 141152
Atg3
Name: autophagy related 3
Synonyms: PC3-96, APG3, 2610016C12Rik, Apg3l
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 67841
Homologene: 6836
Phyh
Name: phytanoyl-CoA hydroxylase
Synonyms: Lnap1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16922
HGNC: HGNC:8940
Homologene: 4530
Cdk5r2
Name: cyclin dependent kinase 5, regulatory subunit 2
Synonyms: p39, B230310J22Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12570
HGNC: HGNC:1776
Homologene: 2924
Bpifc
Name: BPI fold containing family C
Synonyms: Bpil2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 270757
Homologene: 18383
Galntl6
Name: UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6
Synonyms: 1700021K10Rik, 4930431L04Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 270049
Homologene: 65137
Vgll3
Name: vestigial like family member 3
Synonyms: 1700110N18Rik, Vito-2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 73569
VEGA: 16
Homologene: 53442
Alx1
Name: ALX homeobox 1
Synonyms: Cart1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216285
HGNC: HGNC:1494
Homologene: 5075
Gm3149
Name: predicted gene 3149
Type: Gene
Species: Mouse
Chromosome: 14
Homologene: 115686
Dleu7
Name: deleted in lymphocytic leukemia, 7
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239133
VEGA: 14
Homologene: 18293
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to C, chromosome 1 at 38,868,035 bp (GRCm38)
  • G to T, chromosome 1 at 59,191,950 bp (GRCm38)
  • T to C, chromosome 1 at 74,855,345 bp (GRCm38)
  • CTCCTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCA to C, chromosome 1 at 88,266,274 bp (GRCm38)
  • T to A, chromosome 1 at 93,215,384 bp (GRCm38)
  • A to G, chromosome 1 at 131,919,006 bp (GRCm38)
  • A to G, chromosome 1 at 150,734,530 bp (GRCm38)
  • T to C, chromosome 1 at 170,918,380 bp (GRCm38)
  • CAAA to CAA, chromosome 1 at 189,256,694 bp (GRCm38)
  • C to T, chromosome 2 at 4,919,052 bp (GRCm38)
  • C to T, chromosome 2 at 89,575,609 bp (GRCm38)
  • C to A, chromosome 2 at 121,450,724 bp (GRCm38)
  • T to C, chromosome 2 at 121,450,725 bp (GRCm38)
  • T to C, chromosome 2 at 132,806,779 bp (GRCm38)
  • T to C, chromosome 2 at 140,661,670 bp (GRCm38)
  • C to A, chromosome 2 at 150,192,791 bp (GRCm38)
  • T to C, chromosome 2 at 160,904,496 bp (GRCm38)
  • T to C, chromosome 4 at 73,790,696 bp (GRCm38)
  • T to C, chromosome 4 at 123,910,087 bp (GRCm38)
  • T to G, chromosome 4 at 139,360,890 bp (GRCm38)
  • T to G, chromosome 4 at 148,500,118 bp (GRCm38)
  • GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT to GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT, chromosome 5 at 113,819,695 bp (GRCm38)
  • A to G, chromosome 6 at 91,042,626 bp (GRCm38)
  • G to T, chromosome 7 at 19,038,061 bp (GRCm38)
  • A to T, chromosome 7 at 110,946,052 bp (GRCm38)
  • G to A, chromosome 7 at 116,362,054 bp (GRCm38)
  • A to G, chromosome 7 at 118,848,487 bp (GRCm38)
  • AGCTC to AGCTCAGCCACGGGGACCCGCTC, chromosome 7 at 126,467,596 bp (GRCm38)
  • A to T, chromosome 8 at 57,857,515 bp (GRCm38)
  • T to A, chromosome 9 at 44,316,617 bp (GRCm38)
  • T to C, chromosome 9 at 107,792,009 bp (GRCm38)
  • T to C, chromosome 9 at 110,633,998 bp (GRCm38)
  • C to A, chromosome 10 at 7,919,360 bp (GRCm38)
  • A to G, chromosome 10 at 14,431,679 bp (GRCm38)
  • A to T, chromosome 10 at 80,808,900 bp (GRCm38)
  • A to T, chromosome 10 at 85,979,254 bp (GRCm38)
  • T to C, chromosome 10 at 103,028,474 bp (GRCm38)
  • T to C, chromosome 11 at 67,217,919 bp (GRCm38)
  • T to G, chromosome 11 at 69,852,840 bp (GRCm38)
  • A to G, chromosome 12 at 11,255,185 bp (GRCm38)
  • A to G, chromosome 12 at 79,244,465 bp (GRCm38)
  • T to A, chromosome 14 at 4,320,208 bp (GRCm38)
  • A to T, chromosome 14 at 23,390,965 bp (GRCm38)
  • T to C, chromosome 14 at 62,276,902 bp (GRCm38)
  • C to T, chromosome 14 at 64,113,680 bp (GRCm38)
  • A to C, chromosome 14 at 73,206,053 bp (GRCm38)
  • A to G, chromosome 15 at 68,212,803 bp (GRCm38)
  • A to C, chromosome 15 at 98,865,165 bp (GRCm38)
  • A to G, chromosome 16 at 45,159,118 bp (GRCm38)
  • A to G, chromosome 16 at 65,839,343 bp (GRCm38)
  • A to G, chromosome 18 at 37,301,683 bp (GRCm38)
  • G to T, chromosome 18 at 64,887,960 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9482 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069285-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.