Strain Name:
C57BL/6J-MtgxR9485Btlr/Mmmh
Stock Number:
069288-MU
Citation ID:
RRID:MMRRC_069288-MU
Other Names:
R9485 (G1)
Major Collection:

Strain Information

Dnmt3a
Name: DNA methyltransferase 3A
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13435
HGNC: HGNC:2978
Homologene: 7294
Atn1
Name: atrophin 1
Synonyms: atrophin-1, Atr1, Drpla
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13498
HGNC: HGNC:3033
Homologene: 1461
Sox9
Name: SRY (sex determining region Y)-box 9
Synonyms: 2010306G03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20682
Homologene: 294
Mllt1
Name: myeloid/lymphoid or mixed-lineage leukemia; translocated to, 1
Synonyms: BAM11, LTG19, ENL
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 64144
VEGA: 17
HGNC: HGNC:7134
Homologene: 4339
Wdr47
Name: WD repeat domain 47
Synonyms: 1810073M12Rik, nemitin
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99512
Homologene: 8984
Wnt7a
Name: wingless-type MMTV integration site family, member 7A
Synonyms: Wnt-7a, tw
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 22421
Homologene: 20969
Rgs12
Name: regulator of G-protein signaling 12
Synonyms: 4632412M04Rik, 1200016K18Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71729
HGNC: HGNC:9994
Homologene: 2195
Hcrtr1
Name: hypocretin (orexin) receptor 1
Synonyms: OX1R
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230777
HGNC: HGNC:4848
Homologene: 37492
Birc6
Name: baculoviral IAP repeat-containing 6
Synonyms: apollon, Bruce, A430032G04Rik, D630005A10Rik, A430040A19Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12211
Homologene: 7248
Dip2b
Name: disco interacting protein 2 homolog B
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239667
Homologene: 72227
Dph5
Name: diphthamide biosynthesis 5
Synonyms: 2410012M04Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 69740
Homologene: 6471
Gab1
Name: growth factor receptor bound protein 2-associated protein 1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14388
HGNC: HGNC:4066
Homologene: 1542
Zfp985
Name: zinc finger protein 985
Synonyms: Gm13154
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 433804
Homologene: 133076
Taf2
Name: TATA-box binding protein associated factor 2
Synonyms: TAFII150, CIF150, TAF2B, 4732460C16Rik, 150kDa
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 319944
VEGA: 15
Homologene: 31137
Fanci
Name: Fanconi anemia, complementation group I
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 208836
Homologene: 49530
Utp25
Name: UTP25 small subunit processome component
Synonyms: AA408296, Diexf, mDef
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 215193
Homologene: 6170
Hipk2
Name: homeodomain interacting protein kinase 2
Synonyms: Stank, 1110014O20Rik, B230339E18Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 15258
Homologene: 68766
Cacng3
Name: calcium channel, voltage-dependent, gamma subunit 3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 54376
HGNC: HGNC:1407
Homologene: 4767
Vps50
Name: VPS50 EARP/GARPII complex subunit
Synonyms: 8430415E05Rik, 1700034M03Rik, Ccdc132
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 73288
Homologene: 11498
Dhx32
Name: DEAH-box helicase 32 (putative)
Synonyms: Ddx32, DEAH (Asp-Glu-Ala-His) box polypeptide 32
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101437
Homologene: 56798
Sec1
Name: secretory blood group 1
Synonyms: Fut3, GDP-L-fucose:beta-D-galactoside 2-alpha-L-fucosyltransferase FUT-III
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56546
Homologene: 431
Dnajb6
Name: DnaJ heat shock protein family (Hsp40) member B6
Synonyms: Mrj, mDj4
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 23950
Homologene: 38058
Slc25a36
Name: solute carrier family 25, member 36
Synonyms: C330005L02Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 192287
Homologene: 10039
Pcolce2
Name: procollagen C-endopeptidase enhancer 2
Synonyms: Pcpe2, 2400001O18Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 76477
HGNC: HGNC:8739
Homologene: 8357
Fance
Name: Fanconi anemia, complementation group E
Synonyms: 2810451D06Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 72775
HGNC: HGNC:3586
Homologene: 11066
Myh6
Name: myosin, heavy polypeptide 6, cardiac muscle, alpha
Synonyms: alpha myosin, Myhc-a, alpha cardiac MHC, cardiomyopathy, hypertrophic 1, Myhca, A830009F23Rik, alpha-MHC, alphaMHC
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 17888
HGNC: HGNC:7576
Homologene: 124414
Tmprss7
Name: transmembrane serine protease 7
Synonyms: LOC385645, B230219I23Rik, matriptase-3
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 208171
Homologene: 18178
Trpm6
Name: transient receptor potential cation channel, subfamily M, member 6
Synonyms: CHAK2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225997
VEGA: 19
Homologene: 9767
Apoa4
Name: apolipoprotein A-IV
Synonyms: Apoa-4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 11808
HGNC: HGNC:602
Homologene: 47927
Col11a2
Name: collagen, type XI, alpha 2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12815
HGNC: HGNC:2187
Homologene: 22547
Cntnap5c
Name: contactin associated protein-like 5C
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 620292
VEGA: 17
Homologene: 128806
Pus7
Name: pseudouridylate synthase 7
Synonyms: C330017I15Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 78697
Homologene: 6998
Dennd4a
Name: DENN domain containing 4A
Synonyms: F730015K02Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102442
VEGA: 9
Homologene: 55933
Vmn2r3
Name: vomeronasal 2, receptor 3
Synonyms: EG637004
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 637004
Atp7b
Name: ATPase, Cu++ transporting, beta polypeptide
Synonyms: WND, Wilson protein, Atp7a
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11979
HGNC: HGNC:870
Homologene: 20063
Cass4
Name: Cas scaffolding protein family member 4
Synonyms: F730031O20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 320664
Homologene: 75128
Snrpn
Name: small nuclear ribonucleoprotein N
Synonyms: Peg4, 2410045I01Rik, Pwcr1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20646
Homologene: 68297
Mroh8
Name: maestro heat-like repeat family member 8
Synonyms: 4922505G16Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 629499
Homologene: 51864
Ccdc168
Name: coiled-coil domain containing 168
Synonyms: Gm8251
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 102636082
VEGA: 1
Homologene: 141149
Ahnak
Name: AHNAK nucleoprotein
Synonyms: DY6, 2310047C17Rik, 1110004P15Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 66395
VEGA: 19
HGNC: HGNC:347
Homologene: 67425
Il1rl2
Name: interleukin 1 receptor-like 2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 107527
HGNC: HGNC:5999
Homologene: 2860
Pcdh8
Name: protocadherin 8
Synonyms: Papc, 1700080P15Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 18530
HGNC: HGNC:8660
Homologene: 1943
Gpr87
Name: G protein-coupled receptor 87
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 84111
HGNC: HGNC:4538
Homologene: 13021
4930486L24Rik
Name: RIKEN cDNA 4930486L24 gene
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 214639
VEGA: 13
Homologene: 138410
Atp1a2
Name: ATPase, Na+/K+ transporting, alpha 2 polypeptide
Synonyms: Atpa-3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98660
HGNC: HGNC:800
Homologene: 47947
Gbp4
Name: guanylate binding protein 4
Synonyms: Mag-2, Mpa-2, Mpa2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 17472
Homologene: 128731
Gramd1a
Name: GRAM domain containing 1A
Synonyms: 1300003M23Rik, D7Bwg0611e
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 52857
Homologene: 10843
Gzmd
Name: granzyme D
Synonyms: CCP5, Ctla-5, Ctla5
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 14941
Homologene: 133275
3425401B19Rik
Name: RIKEN cDNA 3425401B19 gene
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 100504518
VEGA: 14
Homologene: 54908
Ttbk2
Name: tau tubulin kinase 2
Synonyms: TTK, B930008N24Rik, 2610507N02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 140810
Homologene: 62795
Il22b
Name: interleukin 22B
Synonyms: IL-TIFb, Iltifb
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 116849
Homologene: 9669
Zfp709
Name: zinc finger protein 709
Synonyms: GIOT-4
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 236193
Homologene: 136795
Cnot6l
Name: CCR4-NOT transcription complex, subunit 6-like
Synonyms: 4932442K20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231464
Homologene: 100830
Ift88
Name: intraflagellar transport 88
Synonyms: Tg737, polaris, Oak Ridge polycystic kidneys, orpk, IFT88, fxo, TgN737Rpw, Tg737Rpw, Ttc10
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21821
Homologene: 4761
Erp27
Name: endoplasmic reticulum protein 27
Synonyms: 1810047B09Rik, 1810033M07Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 69187
Homologene: 12303
Ear6
Name: eosinophil-associated, ribonuclease A family, member 6
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 93719
Homologene: 40596
Tacc3
Name: transforming, acidic coiled-coil containing protein 3
Synonyms: Arnt interacting protein, Aint
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 21335
Homologene: 81618
Or52b3
Name: olfactory receptor family 52 subfamily B member 3
Synonyms: GA_x6K02T2PBJ9-5274337-5275287, MOR31-3, Olfr549
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259105
Homologene: 86245
Spmip3
Name: sperm microtubule inner protein 3
Synonyms: 1700016C15Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 69428
Homologene: 19111
Or52e5
Name: olfactory receptor family 52 subfamily E member 5
Synonyms: GA_x6K02T2PBJ9-7698491-7699432, MOR32-5, Olfr678
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258753
Homologene: 27254
Zfp131
Name: zinc finger protein 131
Synonyms: 2610109I01Rik, Znf131
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 72465
VEGA: 13
Homologene: 12464
Or4c110
Name: olfactory receptor family 4 subfamily C member 110
Synonyms: GA_x6K02T2Q125-50482823-50481885, MOR233-13, Olfr1215
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258451
Homologene: 74071
Nfkbie
Name: nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, epsilon
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18037
VEGA: 17
HGNC: HGNC:7799
Homologene: 36160
Ighv1-12
Name: immunoglobulin heavy variable V1-12
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 629860
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT to CTTTATTTTATTTTATTTTATTTTATTTTATTTTATT, chromosome 1 at 40,327,310 bp (GRCm38)
  • T to G, chromosome 1 at 44,056,239 bp (GRCm38)
  • A to G, chromosome 1 at 172,278,255 bp (GRCm38)
  • T to C, chromosome 1 at 177,752,979 bp (GRCm38)
  • C to A, chromosome 1 at 193,130,233 bp (GRCm38)
  • G to A, chromosome 2 at 89,001,365 bp (GRCm38)
  • G to T, chromosome 2 at 120,745,505 bp (GRCm38)
  • T to C, chromosome 2 at 157,229,993 bp (GRCm38)
  • T to C, chromosome 2 at 172,427,885 bp (GRCm38)
  • C to T, chromosome 3 at 59,179,584 bp (GRCm38)
  • T to A, chromosome 3 at 64,275,625 bp (GRCm38)
  • A to T, chromosome 3 at 108,637,055 bp (GRCm38)
  • A to T, chromosome 3 at 115,888,328 bp (GRCm38)
  • T to A, chromosome 4 at 130,137,261 bp (GRCm38)
  • T to A, chromosome 4 at 147,583,823 bp (GRCm38)
  • A to T, chromosome 5 at 23,768,861 bp (GRCm38)
  • C to T, chromosome 5 at 29,781,519 bp (GRCm38)
  • T to C, chromosome 5 at 33,664,300 bp (GRCm38)
  • G to T, chromosome 5 at 35,032,270 bp (GRCm38)
  • T to C, chromosome 5 at 96,082,999 bp (GRCm38)
  • A to T, chromosome 5 at 105,121,930 bp (GRCm38)
  • T to C, chromosome 6 at 3,592,557 bp (GRCm38)
  • C to A, chromosome 6 at 38,703,510 bp (GRCm38)
  • T to A, chromosome 6 at 91,366,315 bp (GRCm38)
  • T to C, chromosome 6 at 124,745,785 bp (GRCm38)
  • T to C, chromosome 6 at 136,909,550 bp (GRCm38)
  • T to G, chromosome 7 at 31,130,538 bp (GRCm38)
  • G to A, chromosome 7 at 45,678,609 bp (GRCm38)
  • C to T, chromosome 7 at 59,987,464 bp (GRCm38)
  • T to A, chromosome 7 at 79,439,657 bp (GRCm38)
  • A to T, chromosome 7 at 102,554,806 bp (GRCm38)
  • C to T, chromosome 7 at 105,069,496 bp (GRCm38)
  • A to T, chromosome 7 at 122,762,212 bp (GRCm38)
  • T to C, chromosome 7 at 133,725,381 bp (GRCm38)
  • T to C, chromosome 8 at 22,012,762 bp (GRCm38)
  • T to A, chromosome 8 at 71,889,825 bp (GRCm38)
  • G to A, chromosome 8 at 80,788,855 bp (GRCm38)
  • T to C, chromosome 9 at 46,241,155 bp (GRCm38)
  • T to G, chromosome 9 at 64,907,106 bp (GRCm38)
  • T to A, chromosome 9 at 95,638,667 bp (GRCm38)
  • T to C, chromosome 9 at 97,080,469 bp (GRCm38)
  • A to G, chromosome 10 at 118,294,409 bp (GRCm38)
  • A to G, chromosome 11 at 112,782,879 bp (GRCm38)
  • G to A, chromosome 12 at 3,866,121 bp (GRCm38)
  • T to C, chromosome 12 at 114,615,905 bp (GRCm38)
  • A to T, chromosome 13 at 60,853,245 bp (GRCm38)
  • A to G, chromosome 13 at 119,790,349 bp (GRCm38)
  • T to C, chromosome 14 at 32,661,443 bp (GRCm38)
  • T to A, chromosome 14 at 51,854,032 bp (GRCm38)
  • T to C, chromosome 14 at 54,944,345 bp (GRCm38)
  • T to A, chromosome 14 at 56,130,703 bp (GRCm38)
  • T to C, chromosome 14 at 57,438,267 bp (GRCm38)
  • A to T, chromosome 14 at 79,768,249 bp (GRCm38)
  • T to C, chromosome 15 at 55,048,271 bp (GRCm38)
  • T to C, chromosome 15 at 100,155,043 bp (GRCm38)
  • T to A, chromosome 16 at 45,677,919 bp (GRCm38)
  • T to A, chromosome 17 at 28,317,505 bp (GRCm38)
  • T to A, chromosome 17 at 34,039,695 bp (GRCm38)
  • C to T, chromosome 17 at 45,560,427 bp (GRCm38)
  • C to T, chromosome 17 at 56,900,184 bp (GRCm38)
  • A to C, chromosome 17 at 58,102,108 bp (GRCm38)
  • T to A, chromosome 17 at 74,638,403 bp (GRCm38)
  • G to A, chromosome 19 at 9,002,074 bp (GRCm38)
  • G to T, chromosome 19 at 18,778,614 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9485 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069288-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.