Strain Name:
C57BL/6J-MtgxR9507Btlr/Mmmh
Stock Number:
069310-MU
Citation ID:
RRID:MMRRC_069310-MU
Other Names:
R9507 (G1)
Major Collection:

Strain Information

Ide
Name: insulin degrading enzyme
Synonyms: 1300012G03Rik, 4833415K22Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 15925
HGNC: HGNC:5381
Homologene: 3645
Actn4
Name: actinin alpha 4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 60595
HGNC: HGNC:166
Homologene: 55857
Nbea
Name: neurobeachin
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 26422
HGNC: HGNC:7648
Homologene: 69190
Baz1b
Name: bromodomain adjacent to zinc finger domain, 1B
Synonyms: Wbscr9, WSTF
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22385
HGNC: HGNC:961
Homologene: 22651
Cep290
Name: centrosomal protein 290
Synonyms: Nphp6, b2b1454Clo, b2b1752Clo, Kiaa
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216274
VEGA: 10
Homologene: 77213
Tmem104
Name: transmembrane protein 104
Synonyms: C630005D06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 320534
Homologene: 9802
Arhgap35
Name: Rho GTPase activating protein 35
Synonyms: P190 RhoGAP, 6430596G11Rik, p190RhoGAP, p190A, Grlf1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232906
HGNC: HGNC:4591
Homologene: 35136
Anln
Name: anillin, actin binding protein
Synonyms: 1110037A17Rik, Scraps, 2900037I21Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 68743
VEGA: 9
Homologene: 41281
Cdk5rap2
Name: CDK5 regulatory subunit associated protein 2
Synonyms: 2900018K03Rik, an
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 214444
Homologene: 49533
Dmxl1
Name: Dmx-like 1
Synonyms: C630007L23Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240283
HGNC: HGNC:2937
Homologene: 21136
Rsf1
Name: remodeling and spacing factor 1
Synonyms: p325, XAP8, Hbxap, C030033M12Rik, 4832420A03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233532
Homologene: 41142
Ccdc191
Name: coiled-coil domain containing 191
Synonyms: 2610015P09Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 212153
Homologene: 19484
Hspa5
Name: heat shock protein 5
Synonyms: Hsce70, Grp78, Bip, D2Wsu17e, Sez7, D2Wsu141e, 78kDa, mBiP, XAP-1 antigen, baffled
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14828
HGNC: HGNC:5238
Homologene: 3908
Ifrd1
Name: interferon-related developmental regulator 1
Synonyms: PC4, Tis7, Ifnl
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 15982
HGNC: HGNC:5456
Homologene: 31043
Tnfrsf10b
Name: tumor necrosis factor receptor superfamily, member 10b
Synonyms: Trail Receptor, Ly98, Killer/Dr5, DR5, TRICK2B, TRAILR2, TRICKB, TRAIL-R2, TRICK2A, KILLER
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21933
VEGA: 14
Homologene: 129806
Gab2
Name: growth factor receptor bound protein 2-associated protein 2
Synonyms: p97, D130058I17Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 14389
Homologene: 69067
Lrfn4
Name: leucine rich repeat and fibronectin type III domain containing 4
Synonyms: SALM3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225875
Homologene: 36415
Rbm19
Name: RNA binding motif protein 19
Synonyms: 1200009A02Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 74111
Homologene: 7158
Itpr3
Name: inositol 1,4,5-triphosphate receptor 3
Synonyms: Itpr-3, Ip3r3, tf
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16440
HGNC: HGNC:6182
Homologene: 1675
St6galnac4
Name: ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 4
Synonyms: ST6GalNAc IV, Siat7d
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20448
Homologene: 7939
Nutm2
Name: NUT family member 2
Synonyms: LOC328250, Gm806
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 328250
Homologene: 128615
Ush2a
Name: usherin
Synonyms: MUSH2A, A930011D15Rik, LOC381317, LOC269160, A930037M10Rik, Ushrn, Ush2a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22283
Homologene: 66151
Xirp2
Name: xin actin-binding repeat containing 2
Synonyms: A530024P18Rik, 2310008C07Rik, 2310003D02Rik, mXin beta, myomaxin, Cmya3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241431
Homologene: 19388
Fhod1
Name: formin homology 2 domain containing 1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234686
Homologene: 136406
Des
Name: desmin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13346
HGNC: HGNC:2770
Homologene: 56469
Myh1
Name: myosin, heavy polypeptide 1, skeletal muscle, adult
Synonyms: MyHC-IId/x, Myhs-f2, Myhs-f, Myhsf2, A530084A17Rik, MYHC-IIX, myosin heavy chain 2X, IId, IId/x
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17879
HGNC: HGNC:7567
Homologene: 133718
Trmt11
Name: tRNA methyltransferase 11
Synonyms: 3110045I18Rik, 2410075D05Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 73681
VEGA: 10
Homologene: 6876
Zfp947
Name: zinc finger protein 947
Synonyms: Gm4769
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 210853
Homologene: 133253
Sppl2c
Name: signal peptide peptidase 2C
Synonyms: 4933407P14Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237958
Homologene: 18491
Pate4
Name: prostate and testis expressed 4
Synonyms: 9530004K16Rik, SVS VII, Svs7, Pate-B
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56872
Homologene: 49624
Rnf139
Name: ring finger protein 139
Synonyms: 4930555P18Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 75841
VEGA: 15
Homologene: 5222
Kcng1
Name: potassium voltage-gated channel, subfamily G, member 1
Synonyms: OTTMUSG00000016048
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241794
HGNC: HGNC:6248
Homologene: 20515
Cyp2j6
Name: cytochrome P450, family 2, subfamily j, polypeptide 6
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13110
HGNC: HGNC:2634
Homologene: 68091
Sh2b1
Name: SH2B adaptor protein 1
Synonyms: Irip, SH2-Bb, SH2-B, Sh2bpsm1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20399
Homologene: 32122
Tusc1
Name: tumor suppressor candidate 1
Synonyms: 2200001D17Rik, TSG-9
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69136
Homologene: 84597
Lrrc15
Name: leucine rich repeat containing 15
Synonyms: 5430427N11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74488
Homologene: 26080
Or51q1
Name: olfactory receptor family 51 subfamily Q member 1
Synonyms: GA_x6K02T2PBJ9-6713641-6714588, MOR5-2, Olfr635
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259122
Homologene: 133592
Chst8
Name: carbohydrate sulfotransferase 8
Synonyms: 1500011J21Rik, GalNAc4ST-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 68947
Homologene: 41483
Acsm2
Name: acyl-CoA synthetase medium-chain family member 2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233799
Homologene: 70404
Or2t49
Name: olfactory receptor family 2 subfamily T member 49
Synonyms: GA_x6K02T2NKPP-912840-913784, MOR275-4, Olfr331
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 100502887
Homologene: 133015
Stxbp6
Name: syntaxin binding protein 6 (amisyn)
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217517
Homologene: 8579
Dimt1
Name: DIM1 rRNA methyltransferase and ribosome maturation factor
Synonyms: 1500031M22Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 66254
VEGA: 13
Homologene: 7047
Il18r1
Name: interleukin 18 receptor 1
Synonyms: Il1rrp, Il18ralpha
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16182
HGNC: HGNC:5988
Homologene: 2861
Or6k2
Name: olfactory receptor family 6 subfamily K member 2
Synonyms: GA_x6K02T2P20D-20995211-20994246, MOR105-10, Olfr420
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 258302
Homologene: 17185
Or10g3b
Name: olfactory receptor family 10 subfamily G member 3B
Synonyms: GA_x6K02T2RJGY-644134-645075, MOR223-10, MOR223-7P, Olfr1513
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 258008
HGNC: HGNC:8171
Homologene: 79404
Gdpd1
Name: glycerophosphodiester phosphodiesterase domain containing 1
Synonyms: 2610020H15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 66569
Homologene: 7069
1810009A15Rik
Name: RIKEN cDNA 1810009A15 gene
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 66276
Homologene: 84408
Or7a39
Name: olfactory receptor family 7 subfamily A member 39
Synonyms: GA_x6K02T2QGN0-2932609-2931677, MOR139-6, Olfr1355
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 257734
Homologene: 136441
Or2a5
Name: olfactory receptor family 2 subfamily A member 5
Synonyms: GA_x6K02T2P3E9-4663051-4662119, MOR261-13, Olfr448
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 258270
HGNC: HGNC:8232
Homologene: 64846
Rpia
Name: ribose 5-phosphate isomerase A
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 19895
Homologene: 6943
Sbk2
Name: SH3-binding domain kinase family, member 2
Synonyms: LOC381836
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381836
Homologene: 30927
Scrt1
Name: scratch family zinc finger 1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 170729
VEGA: 15
Homologene: 113534
Mettl21e
Name: methyltransferase like 21E
Synonyms: LOC381340, 4832428D23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 403183
Homologene: 19006
Nicn1
Name: nicolin 1
Synonyms: 1500032A17Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 66257
Homologene: 11936
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to A, chromosome 1 at 40,474,724 bp (GRCm38)
  • T to A, chromosome 1 at 44,206,376 bp (GRCm38)
  • T to C, chromosome 1 at 75,366,790 bp (GRCm38)
  • T to A, chromosome 1 at 174,158,986 bp (GRCm38)
  • T to A, chromosome 1 at 188,864,740 bp (GRCm38)
  • G to A, chromosome 2 at 32,595,727 bp (GRCm38)
  • T to C, chromosome 2 at 34,774,598 bp (GRCm38)
  • A to T, chromosome 2 at 67,513,936 bp (GRCm38)
  • A to G, chromosome 2 at 168,269,232 bp (GRCm38)
  • T to C, chromosome 3 at 55,665,590 bp (GRCm38)
  • T to C, chromosome 4 at 70,291,873 bp (GRCm38)
  • T to A, chromosome 4 at 93,335,008 bp (GRCm38)
  • C to A, chromosome 4 at 96,518,107 bp (GRCm38)
  • T to C, chromosome 5 at 120,127,167 bp (GRCm38)
  • C to A, chromosome 5 at 135,205,117 bp (GRCm38)
  • G to T, chromosome 6 at 42,896,901 bp (GRCm38)
  • G to A, chromosome 6 at 70,777,393 bp (GRCm38)
  • G to A, chromosome 7 at 4,957,278 bp (GRCm38)
  • A to G, chromosome 7 at 16,563,418 bp (GRCm38)
  • A to T, chromosome 7 at 28,906,972 bp (GRCm38)
  • G to A, chromosome 7 at 34,748,071 bp (GRCm38)
  • A to T, chromosome 7 at 97,304,241 bp (GRCm38)
  • GC to GCGGCGGCGCC, chromosome 7 at 97,579,934 bp (GRCm38)
  • T to G, chromosome 7 at 103,979,991 bp (GRCm38)
  • A to T, chromosome 7 at 119,580,716 bp (GRCm38)
  • CGGGGACCAGCTC to CGGGGACCAGCTCAGCCAAGGGGACCAGCTC, chromosome 7 at 126,467,588 bp (GRCm38)
  • G to A, chromosome 8 at 105,338,062 bp (GRCm38)
  • A to G, chromosome 9 at 22,362,840 bp (GRCm38)
  • A to G, chromosome 9 at 35,608,242 bp (GRCm38)
  • C to T, chromosome 9 at 108,294,509 bp (GRCm38)
  • A to C, chromosome 10 at 30,558,942 bp (GRCm38)
  • A to G, chromosome 10 at 78,879,763 bp (GRCm38)
  • C to A, chromosome 10 at 100,494,923 bp (GRCm38)
  • T to C, chromosome 11 at 58,501,750 bp (GRCm38)
  • A to G, chromosome 11 at 67,211,223 bp (GRCm38)
  • T to C, chromosome 11 at 87,059,438 bp (GRCm38)
  • T to A, chromosome 11 at 104,187,327 bp (GRCm38)
  • T to C, chromosome 11 at 115,200,873 bp (GRCm38)
  • A to C, chromosome 12 at 40,217,226 bp (GRCm38)
  • A to G, chromosome 12 at 45,019,577 bp (GRCm38)
  • A to T, chromosome 13 at 50,467,419 bp (GRCm38)
  • A to G, chromosome 13 at 106,957,148 bp (GRCm38)
  • A to T, chromosome 14 at 52,349,221 bp (GRCm38)
  • A to G, chromosome 14 at 69,777,772 bp (GRCm38)
  • A to G, chromosome 15 at 58,898,815 bp (GRCm38)
  • A to G, chromosome 15 at 76,519,092 bp (GRCm38)
  • T to C, chromosome 16 at 30,274,011 bp (GRCm38)
  • T to C, chromosome 16 at 43,943,829 bp (GRCm38)
  • C to T, chromosome 17 at 22,145,601 bp (GRCm38)
  • G to A, chromosome 17 at 27,118,677 bp (GRCm38)
  • T to A, chromosome 18 at 49,891,500 bp (GRCm38)
  • A to G, chromosome 19 at 4,614,329 bp (GRCm38)
  • A to G, chromosome 19 at 8,889,223 bp (GRCm38)
  • A to T, chromosome 19 at 37,288,137 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9507 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069310-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.