Strain Name:
C57BL/6J-MtgxR9606Btlr/Mmmh
Stock Number:
069399-MU
Citation ID:
RRID:MMRRC_069399-MU
Other Names:
R9606 (G1)
Major Collection:

Strain Information

Myo10
Name: myosin X
Synonyms: myosin-X, D15Ertd600e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 17909
HGNC: HGNC:7593
Homologene: 36328
Vcan
Name: versican
Synonyms: PG-M, hdf, heart defect, 5430420N07Rik, DPEAAE, Cspg2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13003
HGNC: HGNC:2464
Homologene: 3228
Sox9
Name: SRY (sex determining region Y)-box 9
Synonyms: 2010306G03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20682
Homologene: 294
Nrcam
Name: neuronal cell adhesion molecule
Synonyms: Bravo, C030017F07Rik, C130076O07Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319504
VEGA: 12
HGNC: HGNC:7994
Homologene: 21041
Zfp423
Name: zinc finger protein 423
Synonyms: Roaz, ataxia1, Zfp104, Ebfaz
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 94187
Homologene: 9010
Mov10
Name: Mov10 RISC complex RNA helicase
Synonyms: Mov-10
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 17454
HGNC: HGNC:7200
Homologene: 10365
E2f2
Name: E2F transcription factor 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242705
HGNC: HGNC:3114
Homologene: 48264
Zdbf2
Name: zinc finger, DBF-type containing 2
Synonyms: 9330107J05Rik, 4930431J08Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 73884
Homologene: 52868
Zfp384
Name: zinc finger protein 384
Synonyms: C130073D16Rik, Ciz, Nmp4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 269800
Homologene: 15849
Nln
Name: neurolysin (metallopeptidase M3 family)
Synonyms: 4930472G13Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 75805
VEGA: 13
Homologene: 69315
Snx6
Name: sorting nexin 6
Synonyms: 2610032J07Rik, 2010006G21Rik, 2810425K19Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 72183
VEGA: 12
Homologene: 12304
Slc38a2
Name: solute carrier family 38, member 2
Synonyms: 5033402L14Rik, SNAT2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 67760
VEGA: 15
Homologene: 23132
Ndc1
Name: NDC1 transmembrane nucleoporin
Synonyms: 2810475A17Rik, Tmem48, sks
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 72787
Homologene: 41224
Wdr12
Name: WD repeat domain 12
Synonyms: Ytm1, Ytm1p, 4933402C23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 57750
Homologene: 10098
Zbtb18
Name: zinc finger and BTB domain containing 18
Synonyms: RP58, Zfp238
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 30928
Homologene: 21276
Igfl3
Name: IGF-like family member 3
Synonyms: LOC232925, Igfl
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232925
Homologene: 74410
Pcca
Name: propionyl-Coenzyme A carboxylase, alpha polypeptide
Synonyms: C79630
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 110821
HGNC: HGNC:8653
Homologene: 236
Rb1
Name: RB transcriptional corepressor 1
Synonyms: pRb, Rb, Rb-1, retinoblastoma 1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 19645
HGNC: HGNC:9884
Homologene: 272
Srpk2
Name: serine/arginine-rich protein specific kinase 2
Synonyms: mSRPK2, WBP6
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20817
Homologene: 101663
Ubr2
Name: ubiquitin protein ligase E3 component n-recognin 2
Synonyms: 9930021A08Rik, E130209G04Rik, ENSMUSG00000043296
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224826
VEGA: 17
Homologene: 26151
Zfp574
Name: zinc finger protein 574
Synonyms: A630056B21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232976
Homologene: 11238
Cacna1c
Name: calcium channel, voltage-dependent, L type, alpha 1C subunit
Synonyms: (alpha)1 subunit, Cchl1a1, Cav1.2, L-type Cav1.2, D930026N18Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12288
HGNC: HGNC:1390
Homologene: 55484
Cfap74
Name: cilia and flagella associated protein 74
Synonyms: 2010015L04Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 544678
Homologene: 129584
Ttn
Name: titin
Synonyms: connectin, L56, 1100001C23Rik, mdm, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Mmrn2
Name: multimerin 2
Synonyms: EndoGlyx-1, ENDOGLYX1, Emilin3
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105450
VEGA: 14
Homologene: 11697
Fat2
Name: FAT atypical cadherin 2
Synonyms: LOC245827, mKIAA0811, Fath2, EMI2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 245827
HGNC: HGNC:3596
Homologene: 1110
Mrc1
Name: mannose receptor, C type 1
Synonyms: CD206, MR
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17533
HGNC: HGNC:7228
Homologene: 37622
Zfp839
Name: zinc finger protein 839
Synonyms: 2810455K09Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 72805
VEGA: 12
Homologene: 49541
Dgkg
Name: diacylglycerol kinase, gamma
Synonyms: Dagk3, E430001K23Rik, 2900055E17Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 110197
HGNC: HGNC:2853
Homologene: 1029
Nrp1
Name: neuropilin 1
Synonyms: Neuropilin-1, NP-1, NPN-1, Npn1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18186
HGNC: HGNC:8004
Homologene: 2876
Or5b120
Name: olfactory receptor family 5 subfamily B member 120
Synonyms: GA_x6K02T2RE5P-3834960-3835907, MOR202-10, Olfr1477
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258691
Homologene: 110492
Fgl2
Name: fibrinogen-like protein 2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14190
HGNC: HGNC:3696
Homologene: 4864
Tnxb
Name: tenascin XB
Synonyms: Tnx, TN-MHC
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 81877
Homologene: 49589
Skint2
Name: selection and upkeep of intraepithelial T cells 2
Synonyms: OTTMUSG00000008540, B7S3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329919
Homologene: 136741
Ttyh2
Name: tweety family member 2
Synonyms: 1110001A03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 117160
Homologene: 41882
Crybg2
Name: crystallin beta-gamma domain containing 2
Synonyms: Aim1l
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230806
Homologene: 19232
Pitpnm3
Name: PITPNM family member 3
Synonyms: A330068P14Rik, Ackr6
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 327958
Homologene: 66271
Pld2
Name: phospholipase D2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18806
HGNC: HGNC:9068
Homologene: 55672
Ccs
Name: copper chaperone for superoxide dismutase
Synonyms: CCS, Ccsd
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12460
VEGA: 19
HGNC: HGNC:1613
Homologene: 3762
6430548M08Rik
Name: RIKEN cDNA 6430548M08 gene
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234797
Homologene: 8825
Ttc28
Name: tetratricopeptide repeat domain 28
Synonyms: 2310015L07Rik, TPRBK
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 209683
Homologene: 41023
Sp140l1
Name: Sp140 nuclear body protein like 1
Synonyms: LOC381287, A530032D15Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381287
Homologene: 131208
Zfp616
Name: zinc finger protein 616
Synonyms: Gm12330
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 327963
Homologene: 88945
Tsnaxip1
Name: translin-associated factor X (Tsnax) interacting protein 1
Synonyms: TXI1, 1700016K08Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 72236
Homologene: 10194
Vmn1r86
Name: vomeronasal 1 receptor 86
Synonyms: Gm10301
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100312473
Homologene: 74345
Hivep3
Name: human immunodeficiency virus type I enhancer binding protein 3
Synonyms: Krc, 2900056N03Rik, E030045D18Rik, Shn3, Schnurri-3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16656
Homologene: 7803
Tbc1d21
Name: TBC1 domain family, member 21
Synonyms: 1700095K08Rik, MgcRabGAP
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74286
VEGA: 9
Homologene: 14033
Tekt2
Name: tektin 2
Synonyms: tektin-t
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 24084
Homologene: 8043
Sema3g
Name: sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 218877
Homologene: 10602
Lsamp
Name: limbic system-associated membrane protein
Synonyms: Lamp, Lam, B130007O04Rik, D930023J12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 268890
HGNC: HGNC:6705
Homologene: 20533
Ppm1k
Name: protein phosphatase 1K (PP2C domain containing)
Synonyms: 2900063A19Rik, A930026L03Rik, PP2Cm
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243382
Homologene: 36819
Chmp4c
Name: charged multivesicular body protein 4C
Synonyms: 2210015K02Rik, 2010012P02Rik, 2310010I16Rik, Snf7-3, chromatin modifying protein 4C
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 66371
Homologene: 23544
Or6c216
Name: olfactory receptor family 6 subfamily C member 216
Synonyms: GA_x6K02T2PULF-11521598-11520666, MOR110-1, Olfr812
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258791
Homologene: 73931
Or2t29
Name: olfactory receptor family 2 subfamily T member 29
Synonyms: GA_x6K02T2NKPP-882068-883006, MOR275-6P, Olfr329-ps, Olfr329
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 259148
Homologene: 133015
Or8b1d
Name: olfactory receptor family 8 subfamily B member 1D
Synonyms: GA_x6K02T2PVTD-32349884-32348952, MOR167-4, Olfr915
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258781
VEGA: 9
Homologene: 121530
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to G, chromosome 1 at 60,088,067 bp (GRCm38)
  • C to T, chromosome 1 at 63,303,377 bp (GRCm38)
  • G to C, chromosome 1 at 85,097,623 bp (GRCm38)
  • T to A, chromosome 1 at 177,447,423 bp (GRCm38)
  • A to T, chromosome 2 at 14,308,706 bp (GRCm38)
  • C to T, chromosome 2 at 76,885,013 bp (GRCm38)
  • A to T, chromosome 3 at 10,367,162 bp (GRCm38)
  • A to T, chromosome 3 at 104,800,348 bp (GRCm38)
  • T to A, chromosome 4 at 107,389,489 bp (GRCm38)
  • C to T, chromosome 4 at 112,625,950 bp (GRCm38)
  • C to T, chromosome 4 at 120,132,589 bp (GRCm38)
  • T to C, chromosome 4 at 126,324,900 bp (GRCm38)
  • A to T, chromosome 4 at 134,074,072 bp (GRCm38)
  • T to A, chromosome 4 at 136,184,432 bp (GRCm38)
  • A to G, chromosome 4 at 155,424,676 bp (GRCm38)
  • T to C, chromosome 5 at 21,372,993 bp (GRCm38)
  • T to C, chromosome 5 at 23,524,606 bp (GRCm38)
  • G to A, chromosome 5 at 111,285,274 bp (GRCm38)
  • T to C, chromosome 6 at 57,514,072 bp (GRCm38)
  • T to C, chromosome 6 at 118,610,494 bp (GRCm38)
  • T to A, chromosome 6 at 125,030,839 bp (GRCm38)
  • T to A, chromosome 7 at 13,102,814 bp (GRCm38)
  • A to C, chromosome 7 at 18,179,995 bp (GRCm38)
  • A to G, chromosome 7 at 25,081,215 bp (GRCm38)
  • A to T, chromosome 8 at 87,687,967 bp (GRCm38)
  • G to A, chromosome 8 at 105,840,053 bp (GRCm38)
  • A to G, chromosome 8 at 120,153,967 bp (GRCm38)
  • G to A, chromosome 8 at 128,502,548 bp (GRCm38)
  • A to G, chromosome 9 at 38,647,324 bp (GRCm38)
  • T to C, chromosome 9 at 58,361,204 bp (GRCm38)
  • A to T, chromosome 10 at 129,842,756 bp (GRCm38)
  • T to C, chromosome 11 at 55,289,267 bp (GRCm38)
  • C to T, chromosome 11 at 58,542,927 bp (GRCm38)
  • C to T, chromosome 11 at 70,555,067 bp (GRCm38)
  • T to A, chromosome 11 at 72,064,243 bp (GRCm38)
  • T to C, chromosome 11 at 74,085,394 bp (GRCm38)
  • T to A, chromosome 11 at 112,782,590 bp (GRCm38)
  • T to A, chromosome 11 at 114,710,841 bp (GRCm38)
  • A to T, chromosome 12 at 44,562,457 bp (GRCm38)
  • T to C, chromosome 12 at 54,768,026 bp (GRCm38)
  • A to G, chromosome 12 at 110,868,342 bp (GRCm38)
  • A to T, chromosome 13 at 89,705,372 bp (GRCm38)
  • TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC to TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC, chromosome 13 at 104,050,416 bp (GRCm38)
  • T to C, chromosome 14 at 31,221,826 bp (GRCm38)
  • C to A, chromosome 14 at 34,397,697 bp (GRCm38)
  • T to C, chromosome 14 at 73,280,133 bp (GRCm38)
  • T to C, chromosome 14 at 122,664,305 bp (GRCm38)
  • CAGGTATAAAG to CAG, chromosome 15 at 25,776,315 bp (GRCm38)
  • A to G, chromosome 15 at 96,693,291 bp (GRCm38)
  • T to C, chromosome 16 at 22,622,261 bp (GRCm38)
  • A to G, chromosome 16 at 41,888,929 bp (GRCm38)
  • T to G, chromosome 17 at 34,695,604 bp (GRCm38)
  • C to T, chromosome 17 at 46,934,094 bp (GRCm38)
  • A to T, chromosome 19 at 4,832,869 bp (GRCm38)
  • A to T, chromosome 19 at 13,502,579 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9606 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069399-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.