Strain Name:
C57BL/6J-MtgxR9650Btlr/Mmmh
Stock Number:
069443-MU
Citation ID:
RRID:MMRRC_069443-MU
Other Names:
R9650 (G1)
Major Collection:

Strain Information

Hps5
Name: HPS5, biogenesis of lysosomal organelles complex 2 subunit 2
Synonyms: ru-2, ruby eye 2, ru2, Hermansky-Pudlak syndrome 5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 246694
Homologene: 35333
Utrn
Name: utrophin
Synonyms: G-utrophin, Dmdl, DRP
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22288
VEGA: 10
Homologene: 21398
Wasf2
Name: WASP family, member 2
Synonyms: D4Ertd13e, WAVE2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242687
Homologene: 86743
Evl
Name: Ena-vasodilator stimulated phosphoprotein
Synonyms: b2b2600Clo
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 14026
VEGA: 12
Homologene: 56752
Ank2
Name: ankyrin 2, brain
Synonyms: ankyrin B, Ank-2, Ankyrin-2, Ankyrin-B, Gm4392
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109676
HGNC: HGNC:493
Itk
Name: IL2 inducible T cell kinase
Synonyms: Emt, Tsk, Tcsk
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16428
HGNC: HGNC:6171
Homologene: 4051
Pnmt
Name: phenylethanolamine-N-methyltransferase
Synonyms: Pent
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18948
HGNC: HGNC:9160
Homologene: 55673
Epb41l2
Name: erythrocyte membrane protein band 4.1 like 2
Synonyms: NBL2, 4.1G, D10Ertd398e, Epb4.1l2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13822
VEGA: 10
HGNC: HGNC:3379
Homologene: 37478
Cs
Name: citrate synthase
Synonyms: Cis, 2610511A05Rik, 9030605P22Rik, ahl4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 12974
VEGA: 10
HGNC: HGNC:2422
Homologene: 56073
Fzd6
Name: frizzled class receptor 6
Synonyms: Fz6, rst
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 14368
VEGA: 15
HGNC: HGNC:4044
Homologene: 2617
Mid1
Name: midline 1
Synonyms: Fxy, 61B3-R, DXHXS1141, Trim18
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 17318
HGNC: HGNC:7095
Homologene: 7837
Fry
Name: FRY microtubule binding protein
Synonyms: cg003, 9330186A19Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320365
Homologene: 113770
Bptf
Name: bromodomain PHD finger transcription factor
Synonyms: 9430093H17Rik, Falz
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 207165
HGNC: HGNC:3581
Homologene: 114397
Traf2
Name: TNF receptor-associated factor 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22030
Homologene: 22520
Senp1
Name: SUMO1/sentrin specific peptidase 1
Synonyms: 2310046A20Rik, E330036L07Rik, D15Ertd528e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223870
Homologene: 8731
Unc13d
Name: unc-13 homolog D
Synonyms: Munc13-4, 2610108D09Rik, Jinx
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70450
Homologene: 26714
Tmem135
Name: transmembrane protein 135
Synonyms: 2810439K08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72759
Homologene: 11295
Kcnh5
Name: potassium voltage-gated channel, subfamily H (eag-related), member 5
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238271
VEGA: 12
HGNC: HGNC:6254
Homologene: 15858
Lhfpl4
Name: lipoma HMGIC fusion partner-like protein 4
Synonyms: 1190004M23Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 269788
Homologene: 14943
Pcx
Name: pyruvate carboxylase
Synonyms: Pc
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18563
VEGA: 19
HGNC: HGNC:8636
Homologene: 5422
Adam33
Name: a disintegrin and metallopeptidase domain 33
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 110751
Homologene: 11881
Muc16
Name: mucin 16
Synonyms: LOC385009, 1110008I14Rik, Gm21044
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73732
Homologene: 141193
Dync2h1
Name: dynein cytoplasmic 2 heavy chain 1
Synonyms: DHC1b, DHC2, 4432416O06Rik, D330044F14Rik, D030010H02Rik, Dnchc2, b2b414Clo, m407Asp, m152Asp
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 110350
HGNC: HGNC:2962
Homologene: 14468
Tln1
Name: talin 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21894
Homologene: 21267
Cpq
Name: carboxypeptidase Q
Synonyms: HLS2, 1190003P12Rik, 2610034C17Rik, Lal-1, Pgcp
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 54381
VEGA: 15
Homologene: 9401
Rnf115
Name: ring finger protein 115
Synonyms: 2610028E05Rik, Zfp364, Rabring7
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67845
Homologene: 69167
Ino80
Name: INO80 complex subunit
Synonyms: 2310079N15Rik, INO80, 4632409L19Rik, Inoc1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68142
Homologene: 75070
Tubgcp3
Name: tubulin, gamma complex component 3
Synonyms: Spc98p, GCP3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 259279
Homologene: 4609
Slc29a3
Name: solute carrier family 29 (nucleoside transporters), member 3
Synonyms: Ent3, 4933435C21Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71279
Homologene: 56805
Nutm2
Name: NUT family member 2
Synonyms: LOC328250, Gm806
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 328250
Homologene: 128615
Usp2
Name: ubiquitin specific peptidase 2
Synonyms: ubp41, B930035K21Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 53376
Homologene: 3098
Or51f2
Name: olfactory receptor family 51 subfamily F member 2
Synonyms: GA_x6K02T2PBJ9-5588278-5589228, MOR14-3, MOR14-11, Olfr568
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259095
Homologene: 81595
Stab2
Name: stabilin 2
Synonyms: STAB-2, FEEL-2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 192188
Homologene: 23022
Or4c109
Name: olfactory receptor family 4 subfamily C member 109
Synonyms: GA_x6K02T2Q125-50468705-50467770, MOR233-8, Olfr1214
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258899
Homologene: 73984
Cyp2b19
Name: cytochrome P450, family 2, subfamily b, polypeptide 19
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13090
HGNC: HGNC:2615
Homologene: 104114
Fras1
Name: Fraser extracellular matrix complex subunit 1
Synonyms: bl, E130113P14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231470
Homologene: 23516
Tnxb
Name: tenascin XB
Synonyms: Tnx, TN-MHC
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 81877
Homologene: 49589
Abca6
Name: ATP-binding cassette, sub-family A member 6
Synonyms: 6330565N06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76184
HGNC: HGNC:36
Homologene: 71264
Ngef
Name: neuronal guanine nucleotide exchange factor
Synonyms: ephexin, Tims2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 53972
HGNC: HGNC:7807
Homologene: 75120
Agap2
Name: ArfGAP with GTPase domain, ankyrin repeat and PH domain 2
Synonyms: Centg1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216439
VEGA: 10
Homologene: 86815
BC005537
Name: cDNA sequence BC005537
Synonyms: 8030460C05Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 79555
Homologene: 11551
Fam76a
Name: family with sequence similarity 76, member A
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230789
Homologene: 27071
Vil1
Name: villin 1
Synonyms: Villin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22349
Homologene: 5169
Cps1
Name: carbamoyl-phosphate synthetase 1
Synonyms: CPS, CPSase I, 4732433M03Rik, D1Ucla3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227231
HGNC: HGNC:2323
Homologene: 68208
Cox15
Name: cytochrome c oxidase assembly protein 15
Synonyms: 2900026G05Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226139
HGNC: HGNC:2263
Homologene: 5848
Serpina3f
Name: serine (or cysteine) peptidase inhibitor, clade A, member 3F
Synonyms: 2A1, antitrypsin, alpha-1 antiproteinasin
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238393
HGNC: HGNC:16
Homologene: 115927
Hip1r
Name: huntingtin interacting protein 1 related
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 29816
Homologene: 78348
Evc
Name: EvC ciliary complex subunit 1
Synonyms: Ellis van Creveld gene syndrome
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 59056
HGNC: HGNC:3497
Homologene: 10949
Itgax
Name: integrin alpha X
Synonyms: CD11C (p150) alpha polypeptide, Cd11c, CR4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16411
HGNC: HGNC:6152
Homologene: 55493
Actl10
Name: actin-like 10
Synonyms: 1700007I08Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 70362
Homologene: 128516
Klhl40
Name: kelch-like 40
Synonyms: 2310024D23Rik, Kbtbd5
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72330
VEGA: 9
Homologene: 17571
Iigp1c
Name: interferon inducible GTPase 1C
Synonyms: Gm4951
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240327
Zfp865
Name: zinc finger protein 865
Synonyms: 6430526N21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 319748
Homologene: 19652
Dmgdh
Name: dimethylglycine dehydrogenase precursor
Synonyms: 1200014D15Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 74129
Homologene: 8372
Tmem102
Name: transmembrane protein 102
Synonyms: Tmem102-ps, Cbap
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380705
Homologene: 86820
Pate13
Name: prostate and testis expressed 13
Synonyms: 9230113P08Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 77908
Pcdhga8
Name: protocadherin gamma subfamily A, 8
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93716
HGNC: HGNC:8706
Homologene: 57162
Rrp7a
Name: ribosomal RNA processing 7 homolog A
Synonyms: 1110014J01Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 74778
Homologene: 41060
Ighv1-34
Name: immunoglobulin heavy variable 1-34
Synonyms: Gm16735
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 628614
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to C, chromosome 1 at 67,215,477 bp (GRCm38)
  • C to T, chromosome 1 at 74,425,616 bp (GRCm38)
  • T to A, chromosome 1 at 87,487,830 bp (GRCm38)
  • A to C, chromosome 2 at 25,520,442 bp (GRCm38)
  • A to T, chromosome 2 at 88,987,662 bp (GRCm38)
  • C to T, chromosome 2 at 119,446,983 bp (GRCm38)
  • C to T, chromosome 2 at 131,053,069 bp (GRCm38)
  • T to A, chromosome 2 at 154,552,762 bp (GRCm38)
  • C to T, chromosome 3 at 96,758,021 bp (GRCm38)
  • T to A, chromosome 3 at 126,942,180 bp (GRCm38)
  • G to A, chromosome 4 at 43,545,912 bp (GRCm38)
  • T to C, chromosome 4 at 132,902,076 bp (GRCm38)
  • T to A, chromosome 4 at 133,190,146 bp (GRCm38)
  • G to A, chromosome 5 at 37,300,818 bp (GRCm38)
  • G to T, chromosome 5 at 96,762,528 bp (GRCm38)
  • T to C, chromosome 5 at 123,997,294 bp (GRCm38)
  • T to C, chromosome 5 at 150,445,910 bp (GRCm38)
  • T to C, chromosome 6 at 113,194,186 bp (GRCm38)
  • A to G, chromosome 7 at 5,034,684 bp (GRCm38)
  • G to A, chromosome 7 at 26,766,783 bp (GRCm38)
  • A to G, chromosome 7 at 46,775,930 bp (GRCm38)
  • G to C, chromosome 7 at 89,147,978 bp (GRCm38)
  • T to C, chromosome 7 at 102,877,780 bp (GRCm38)
  • T to C, chromosome 7 at 128,135,763 bp (GRCm38)
  • A to G, chromosome 8 at 12,655,974 bp (GRCm38)
  • A to T, chromosome 9 at 7,174,849 bp (GRCm38)
  • A to T, chromosome 9 at 18,642,466 bp (GRCm38)
  • A to C, chromosome 9 at 35,909,503 bp (GRCm38)
  • C to A, chromosome 9 at 44,089,179 bp (GRCm38)
  • T to A, chromosome 9 at 121,780,017 bp (GRCm38)
  • T to C, chromosome 10 at 12,738,185 bp (GRCm38)
  • A to G, chromosome 10 at 25,493,597 bp (GRCm38)
  • T to A, chromosome 10 at 60,750,523 bp (GRCm38)
  • ACC to AC, chromosome 10 at 86,856,697 bp (GRCm38)
  • G to A, chromosome 10 at 127,091,784 bp (GRCm38)
  • T to A, chromosome 10 at 128,360,987 bp (GRCm38)
  • A to T, chromosome 11 at 46,331,951 bp (GRCm38)
  • T to C, chromosome 11 at 69,805,043 bp (GRCm38)
  • A to T, chromosome 11 at 98,387,436 bp (GRCm38)
  • T to C, chromosome 11 at 107,044,586 bp (GRCm38)
  • T to A, chromosome 11 at 110,180,620 bp (GRCm38)
  • AATGCCTCCCATGCC to AATGCCTCCCATGCCTCCCATGCC, chromosome 11 at 116,068,172 bp (GRCm38)
  • A to C, chromosome 12 at 74,976,519 bp (GRCm38)
  • G to A, chromosome 12 at 104,220,260 bp (GRCm38)
  • C to A, chromosome 12 at 108,675,439 bp (GRCm38)
  • G to T, chromosome 12 at 114,851,265 bp (GRCm38)
  • T to A, chromosome 13 at 24,802,139 bp (GRCm38)
  • A to T, chromosome 13 at 50,469,719 bp (GRCm38)
  • A to T, chromosome 13 at 93,708,825 bp (GRCm38)
  • A to T, chromosome 15 at 33,497,259 bp (GRCm38)
  • A to G, chromosome 15 at 39,031,546 bp (GRCm38)
  • A to T, chromosome 15 at 83,119,890 bp (GRCm38)
  • A to T, chromosome 15 at 98,048,367 bp (GRCm38)
  • G to A, chromosome 17 at 34,711,655 bp (GRCm38)
  • T to A, chromosome 18 at 37,727,466 bp (GRCm38)
  • T to G, chromosome 18 at 60,246,398 bp (GRCm38)
  • C to T, chromosome 19 at 4,607,686 bp (GRCm38)
  • A to G, chromosome 19 at 43,746,879 bp (GRCm38)
  • C to G, chromosome X at 169,985,007 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9650 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069443-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.