Strain Name:
C57BL/6J-MtgxR9678Btlr/Mmmh
Stock Number:
069471-MU
Citation ID:
RRID:MMRRC_069471-MU
Other Names:
R9678 (G1)
Major Collection:

Strain Information

Utrn
Name: utrophin
Synonyms: G-utrophin, Dmdl, DRP
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22288
VEGA: 10
Homologene: 21398
Pik3r1
Name: phosphoinositide-3-kinase regulatory subunit 1
Synonyms: p85alpha, p50alpha, p55alpha, PI3K
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18708
HGNC: HGNC:8979
Homologene: 7889
Tagln3
Name: transgelin 3
Synonyms: 2900005O10Rik, 2700038H05Rik, Np25
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 56370
Homologene: 22337
Adgre1
Name: adhesion G protein-coupled receptor E1
Synonyms: F4/80, DD7A5-7, TM7LN3, EGF-TM7, Ly71, Emr1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13733
VEGA: 17
HGNC: HGNC:3336
Homologene: 1493
Cdca2
Name: cell division cycle associated 2
Synonyms: 2610311M19Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 108912
Homologene: 18444
Trpm7
Name: transient receptor potential cation channel, subfamily M, member 7
Synonyms: 5033407O22Rik, 4833414K03Rik, Ltpr7, CHAK1, CHAK, TRP-PLIK, 2310022G15Rik, LTRPC7
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 58800
Homologene: 9774
Atr
Name: ataxia telangiectasia and Rad3 related
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 245000
HGNC: HGNC:882
Homologene: 96916
Trim24
Name: tripartite motif-containing 24
Synonyms: Tif1a, D430004I05Rik, A130082H20Rik, TIF1alpha
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 21848
Homologene: 20830
Dock4
Name: dedicator of cytokinesis 4
Synonyms: EST N28122, 6330411N01Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238130
VEGA: 12
Homologene: 56680
Meaf6
Name: MYST/Esa1-associated factor 6
Synonyms: 2810036M01Rik, 2310005N01Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 70088
Homologene: 11240
H3f3a
Name: H3.3 histone A
Synonyms: H3.3A, H3-3a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 15078
Homologene: 134170
Tenm4
Name: teneurin transmembrane protein 4
Synonyms: l(7)-3Rn, Ten-m4, Doc4, l7Rn3, ELM2, Odz4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 23966
Homologene: 8034
Sult1a1
Name: sulfotransferase family 1A, phenol-preferring, member 1
Synonyms: Stp1, PST
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20887
Homologene: 128224
Crnkl1
Name: crooked neck pre-mRNA splicing factor 1
Synonyms: crn, 1200013P10Rik, 5730590A01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66877
Homologene: 6462
Trub1
Name: TruB pseudouridine (psi) synthase family member 1
Synonyms: 9030425C13Rik, 2610009I02Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 72133
VEGA: 19
Homologene: 34714
Inpp4a
Name: inositol polyphosphate-4-phosphatase, type I
Synonyms: 107kDa
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 269180
HGNC: HGNC:6074
Homologene: 2871
Ehbp1
Name: EH domain binding protein 1
Synonyms: Flj21950, KIAA0903-like
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216565
Homologene: 22880
Parm1
Name: prostate androgen-regulated mucin-like protein 1
Synonyms: 2210012L08Rik, 9130213B05Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231440
Homologene: 41036
Nphp3
Name: nephronophthisis 3 (adolescent)
Synonyms: D330020E01Rik, 3632410F03Rik, pcy, nephrocystin 3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74025
HGNC: HGNC:7907
Homologene: 32697
Sdk2
Name: sidekick cell adhesion molecule 2
Synonyms: 5330435L01Rik, 4632412F08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237979
Homologene: 10406
Xirp2
Name: xin actin-binding repeat containing 2
Synonyms: A530024P18Rik, 2310008C07Rik, 2310003D02Rik, mXin beta, myomaxin, Cmya3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241431
Homologene: 19388
C4b
Name: complement C4B (Chido blood group)
Synonyms: Ss, C4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12268
Homologene: 36030
Vmn2r89
Name: vomeronasal 2, receptor 89
Synonyms: V2r11, V2r10
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 22301
Fsd2
Name: fibronectin type III and SPRY domain containing 2
Synonyms: Spryd1, 9830160G03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244091
Homologene: 18252
Rbsn
Name: rabenosyn, RAB effector
Synonyms: 5330426D11Rik, Rabenosyn-5, Zfyve20
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 78287
Homologene: 41477
Zbbx
Name: zinc finger, B-box domain containing
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 213234
Homologene: 11661
Or1i2
Name: olfactory receptor family 1 subfamily I member 1
Synonyms: GA_x6K02T2QGN0-3196801-3197742, MOR128-4, MOR128-3, Olfr1357
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 257883
HGNC: HGNC:8207
Homologene: 72920
Slfn8
Name: schlafen 8
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 276950
Homologene: 45432
Vmn2r14
Name: vomeronasal 2, receptor 14
Synonyms: EG231591
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231591
Homologene: 129606
Ugt2b5
Name: UDP glucuronosyltransferase 2 family, polypeptide B5
Synonyms: Udpgt-3, m-1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22238
Homologene: 137225
Clec12a
Name: C-type lectin domain family 12, member a
Synonyms: Micl
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232413
Homologene: 51378
Or5k17
Name: olfactory receptor family 5 subfamily K member 17
Synonyms: GA_x54KRFPKG5P-55145984-55145034, MOR184-4, Olfr181
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 259001
Homologene: 74112
Gm10153
Name: predicted gene 10153
Type: Gene
Species: Mouse
Chromosome: 7
Ugdh
Name: UDP-glucose dehydrogenase
Synonyms: Udpgdh
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22235
Homologene: 2520
Cdkn1c
Name: cyclin dependent kinase inhibitor 1C
Synonyms: Kip2, p57Kip2, CDKI
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12577
HGNC: HGNC:1786
Homologene: 134519
Gm10837
Name: predicted gene 10837
Type: Gene
Species: Mouse
Chromosome: 14
Igkv10-96
Name: immunoglobulin kappa variable 10-96
Synonyms: Gm16637
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 692165
Gm10376
Name: predicted gene 10376
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 100042130
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to C, chromosome 1 at 37,366,871 bp (GRCm38)
  • A to G, chromosome 1 at 180,810,115 bp (GRCm38)
  • A to T, chromosome 2 at 67,509,444 bp (GRCm38)
  • C to A, chromosome 2 at 126,844,370 bp (GRCm38)
  • A to T, chromosome 2 at 145,919,955 bp (GRCm38)
  • A to G, chromosome 3 at 75,139,534 bp (GRCm38)
  • A to G, chromosome 4 at 125,102,896 bp (GRCm38)
  • A to G, chromosome 5 at 65,424,127 bp (GRCm38)
  • A to C, chromosome 5 at 87,125,327 bp (GRCm38)
  • A to G, chromosome 5 at 91,594,285 bp (GRCm38)
  • A to G, chromosome 5 at 109,216,175 bp (GRCm38)
  • T to C, chromosome 6 at 37,965,514 bp (GRCm38)
  • T to A, chromosome 6 at 68,632,240 bp (GRCm38)
  • T to C, chromosome 6 at 92,211,638 bp (GRCm38)
  • C to A, chromosome 6 at 129,353,665 bp (GRCm38)
  • T to C, chromosome 7 at 81,559,701 bp (GRCm38)
  • A to G, chromosome 7 at 96,737,412 bp (GRCm38)
  • C to T, chromosome 7 at 126,674,364 bp (GRCm38)
  • C to A, chromosome 7 at 142,189,986 bp (GRCm38)
  • T to C, chromosome 7 at 143,460,646 bp (GRCm38)
  • C to T, chromosome 9 at 95,910,557 bp (GRCm38)
  • T to C, chromosome 9 at 104,023,487 bp (GRCm38)
  • G to T, chromosome 10 at 12,739,415 bp (GRCm38)
  • C to T, chromosome 10 at 78,611,883 bp (GRCm38)
  • T to C, chromosome 11 at 22,151,108 bp (GRCm38)
  • T to C, chromosome 11 at 83,016,897 bp (GRCm38)
  • G to T, chromosome 11 at 113,794,963 bp (GRCm38)
  • TGTGCCGGTGCCGGTGCCGGTGCCGGTGCC to TGTGCCGGTGCCGGTGCCGGTGCCGGTGCCGGTGCC, chromosome 12 at 40,844,380 bp (GRCm38)
  • TGCCGG to TGCCGGCGCCGG, chromosome 12 at 40,844,388 bp (GRCm38)
  • CGGTGC to CGGTGCGGGTGC, chromosome 12 at 40,844,397 bp (GRCm38)
  • G to T, chromosome 13 at 101,702,781 bp (GRCm38)
  • A to T, chromosome 14 at 43,015,567 bp (GRCm38)
  • A to G, chromosome 14 at 51,456,054 bp (GRCm38)
  • A to T, chromosome 14 at 67,700,329 bp (GRCm38)
  • A to T, chromosome 14 at 122,491,026 bp (GRCm38)
  • T to A, chromosome 16 at 45,724,242 bp (GRCm38)
  • A to G, chromosome 16 at 58,926,277 bp (GRCm38)
  • A to G, chromosome 17 at 34,741,789 bp (GRCm38)
  • A to G, chromosome 17 at 57,443,997 bp (GRCm38)
  • A to T, chromosome 19 at 57,458,117 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9678 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069471-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.