Strain Name:
C57BL/6-Tg(Irgm1-DsRed)1Nci/Mmjax
Stock Number:
069613-JAX
Citation ID:
RRID:MMRRC_069613-JAX
Other Names:
M1Red mice (Tg(Irgm1-DsRed)Nci)

Strain Information

Tg(Irgm1-DsRed)1Nci
Name: transgene insertion 1, Lionel Feigenbaum
Type: Allele
Species: Multi-species
Chromosome: Unknown
Irgm1
Name: immunity-related GTPase family M member 1
Synonyms: LRG-47, Iigp3, Ifi1, Irgm
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15944
Homologene: 134089
Genetic Alterations

Random insertion of a DsRed2 transgene construct driven by the mouse Irgm1 promoter.

ES Cell Line
Not applicable
Phenotype
Transgenic mice are healthy, fertile, and breed normally. No growth defect was observed.

Different to many transgenic mouse strains, which were generated for visualizing cytokine expression, M1Red mice report cytokine signaling. By crossing the reporter mice to mice deficient for the individual IFN receptor or STAT, the reporter mouse line can be utilized to study type I, II, and III IFN biology in vivo.
MeSH Terms
  • Alveolar Epithelial Cells/metabolism
  • Animals
  • Cells, Cultured
  • Female
  • GTP-Binding Proteins/genetics
  • GTP-Binding Proteins/metabolism
  • Hematopoietic Stem Cells/metabolism
  • Interferons/metabolism
  • Male
  • Mice
  • Mice, Inbred C57BL
  • Orthomyxoviridae Infections/metabolism
  • Signal Transduction
Strain Development
The protein-coding sequence of DsRed2 was inserted into the ATG translational start site of the sequence encoding Irgm1 in the BAC clone RP23-305A21 by the galK replacement method. Following sequence verification of the modified BAC-construct, transgenic mice were generated by pronuclear injection of the BAC construct into fertilized C57BL/6 eggs. Transgene-positive founder mice were crossed to C57BL/6 animals to verify germline transmission. M1Red mice were genotyped for the DsRed2 gene by standard endpoint PCR using forward (GCTCCAAGGTGTACGT GAAG) and reverse (GCTTGGAGTCCACGTAGTAG) primers.
Suggested Control Mice
C57BL/6
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact csmmrrc@jax.org. Older strains may not have this information.
  • Immunology and Inflammation
Donor
Alan Sher, Ph.D., National Institutes of Health (NIH).
Lionel Feigenbaum, Ph.D., Biogen.
Primary Reference

Stifter SA, Bhattacharyya N, Sawyer AJ, Cootes TA, Stambas J, Doyle SE, Feigenbaum L, Paul WE, Britton WJ, Sher A, Feng CG. Visualizing the Selectivity and Dynamics of Interferon Signaling In Vivo. Cell Rep. 2019 Dec 10;29(11):3539-3550.e4. doi: 10.1016/j.celrep.2019.11.021. (Medline PMID: 31825834)

Colony and Husbandry Information

The donor bred the mice as "homozygotes," but recommends using heterozygotes (offspring from the cross between “homozygote” to WT B6 mouse), to avoid the possibility of mixed offspring genotype.

Cryo-recovered strains distributed by the MMRRC at JAX are shipped to the customer from the Pathogen & Opportunistic-Free Animal Room G200 - see https://www.jax.org/jax-mice-and-services/customer-support/customer-service/animal-health/health-status-reports.

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email csmmrrc@jax.org.
Coat Color
Black
Eye
Black
MMRRC Breeding System
Other or uncertain
Generation
N?F?
Overall Breeding Performance
Good
NOTE: "Hemizygote" as used here refers to males carrying a mutation on the X Chromosome or mice of either sex carrying an inserted transgene with no homologous allele on the other chromosome.
Viability and Fertility: Female Male Comments
Homozygotes are viable: Yes Yes
Homozygotes are fertile: Yes Yes
Hetero/Hemizygotes are fertile: Yes Yes
Age Reproductive Decline: Undetermined Undetermined
Average litter size
4 to 6
Recommended wean age
4 Weeks
Average Pups Weaned
4 to 6

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069613-JAX-SPERM Cryo-preserved spermatozoa $437.00 / $437.00
Non-Profit / For-Profit
Aliquot Approximate quantity3
069613-JAX-RESUS Litter recovered from cryo-archive $2,022.00 / $2,022.00
Non-Profit / For-Profit
Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.