Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-Kmt2aem1Lutzy/Mmjax
Stock Number:
069629-JAX
Citation ID:
RRID:MMRRC_069629-JAX
Other Names:
Kmt2a cKO

Strain Information

Kmt2aem1Lutzy
Name: lysine (K)-specific methyltransferase 2A; endonuclease-mediated mutation 1, Cathy Lutz
Synonyms: Kmt2a cKO
Type: Allele
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: CRISPR
Kmt2a
Name: lysine (K)-specific methyltransferase 2A
Synonyms: trithorax Drosophila, HTRX1, ALL-1, All1, Cxxc7, Mll, Mll1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 214162
HGNC: HGNC:7132
Homologene: 4338
Genetic Alterations
Kmt2a cKO is a CRISPR/Cas9 generated mutant of the lysine (K)-specific methyltransferase 2A gene with loxP sites flanking exon 2. Exposure to Cre recombinase deletes the floxed sequence and is expected to create a null allele. These mice may be useful in studying Wiedemann-Steiner Syndrome.
ES Cell Line
Not applicable
Phenotype

The Kmt2a (lysine (K)-specific methyltransferase 2A, also known as MLL)) encodes a histone modification enzyme involved in the regulation of gene expression in early development and hematopoiesis. Mutations in Kmt2a are associated with Wiedemann-Steiner Syndrome a condition characterized by developmental delay, short stature, some facial dysmorphia and low muscle tone.

To create the Kmt2a cKO conditional allele, CRISPR/Cas9 endonuclease-mediated genome editing of Kmt2a exon 2 was used to introduce loxP sites flanking exon 2. Prior to Cre recombinase exposure, mice heterozygous or homozygous for this floxed allele are viable and fertile, with no reported phenotypic abnormalities. Upon exposure to Cre recombinase, deletion of the floxed sequences results in a null allele.

Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
  • Developmental Biology
  • Models for Human Disease
Submitter
Cat Lutz, Ph.D., The Jackson Laboratory.
Primary Reference
Not ready to publish
Strain Development
The Kmt2aem1Lutzy (Kmt2a cKO) allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing at The Jackson Laboratory. Guide RNAs upstream (GGACCTGTAGTTTGAAATTC and GAATTTCAAACTACAGGTCC) and downstream (AGTAAGGATGATTGCAGCCC and GCTCACACAGTTTCCTGGCC) of exon 2 were selected to insert loxP sites in the lysine (K)-specific methyltransferase 2A locus on Chromosome 9. These sequences and Cas9 nuclease were introduced into C57BL/6J zygotes, and then transferred to pseudopregnant females. Progeny were screened by DNA sequencing of the targeted region and the desired allele was identified. This founder was bred to C57BL/6J (Stock No. 000664) for germline transmission. The colony was backcrossed to C57BL/6J for a total of at least two generations.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Cryo-recovered strains distributed by the MMRRC at JAX are shipped to the customer from the Pathogen & Opportunistic-Free Animal Room G200 - see https://www.jax.org/jax-mice-and-services/customer-support/customer-service/animal-health/health-status-reports.

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email csmmrrc@jax.org.
Coat Color
Black
Eye
Black
MMRRC Breeding System
Backcross and sib-mating
Generation
N2 (C57BL/6J), F?
Overall Breeding Performance
Undetermined
NOTE: "Hemizygote" as used here refers to males carrying a mutation on the X Chromosome or mice of either sex carrying an inserted transgene with no homologous allele on the other chromosome.
Viability and Fertility: Female Male Comments
Homozygotes are viable: Yes Yes
Homozygotes are fertile: Yes Yes
Hetero/Hemizygotes are fertile: Yes Yes
Age Reproductive Decline: Undetermined Undetermined
Average litter size
Undetermined
Recommended wean age
4 Weeks
Average Pups Weaned
Undetermined

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069629-JAX-SPERM Cryo-preserved spermatozoa $473.00 / $473.00
Non-Profit / For-Profit
Aliquot Approximate quantity3
069629-JAX-RESUS Litter recovered from cryo-archive $2,187.00 / $2,187.00
Non-Profit / For-Profit
Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.