Strain Name:
B6J.B6NTac-Aldh1a1em1(icre)Awar/Mmmh
Stock Number:
069932-MU
Citation ID:
RRID:MMRRC_069932-MU
Other Names:
Aldh1a1-iCre

Strain Information

Aldh1a1tm1(cre/ERT2)Awar
Name: aldehyde dehydrogenase family 1, subfamily A1; targeted mutation 1, Rajeshwar Awatramani
Synonyms: Aldh1a1-CreERT2
Type:
Species: Mus musculus (mouse)
Chromosome:
Alteration at locus: CRISPR
Aldh1a1
Name: aldehyde dehydrogenase family 1, subfamily A1
Synonyms: ALDH1, E1, Ahd-2, Ahd2, Raldh1
Type: Gene
Species: Mouse
Chromosome: 19
Alteration at locus: CRISPR
NCBI: 11668
HGNC: HGNC:402
Homologene: 110441
Genetic Alterations
CRISPR/Cas9 mediated HDR was used to insert P2A-iCRE-bGHpA after last codon of Aldh1a1 gene.
ES Cell Line
PRX-B6N
Phenotype
None/Normal/Wild-type
Strain Development
A P2A peptide directly followed by iCre and a BGH polyA sequence were inserted after the last encoded amino acid of Aldh1a1, using CRISPR mediated HDR (Guides 1-2 ACGACTATGCTGGTTAC, TCCCCCTTTAGGGG TGAGCA). First, PRXB6/N ES cells were electroporated and screened for insertion and correct locus with multiple primer pairs (Aldh1a1-iCre insertion primers Forward 1-3 CTATTCACTTGCAGTTGGCTTGG, GCTTGGAGGTTTCCTAAGTGTG, AGATCCCTGATGGAGAACTCTG and Reverse 1-3 GTCCAGGGTTCTCCTCCACG, GCATGATTTCAGGGATGGACAC, CATCCTTGGCACCATAGATCAG) followed by Sanger sequencing of iCre+ clones from outside the homology arms through the construct in order to confirm fidelity of the insertion. Clone C7 was expanded and injected into blastocysts to generate chimeras and used for all experiments herein. Aldh1a1-iCre mice were genotyped using primer set 3 described above.
Suggested Control Mice
C57B6/J
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
  • Developmental Biology
  • Neurobiology
Donor
Rajeshwar Awatramani, Ph.D., Northwestern University.
Primary Reference
In preparation, submitted, or in press

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
Eye
Black
MMRRC Breeding System
Backcross
Breeding Scheme(s)
Backcross to C57BL/6J (Jax strain code 664).
Generation
>6
Overall Breeding Performance
Excellent
Viability and Fertility: Female Male Comments
Homozygotes are viable: Yes Yes
Homozygotes are fertile: Undetermined Undetermined
Heterozygotes are fertile: Yes Yes
Age Reproductive Decline: Undetermined Undetermined
Bred to Homozygosity
Yes
Average litter size
7 to 9
Recommended wean age
3 Weeks
Average Pups Weaned
7 to 9

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

A Commercial License Agreement from the Donor is required for for-profit entities to use this strain. For more information, please contact Northwestern Office of Innovation and New Ventures.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

A Commercial License Agreement from the Donor is required for for-profit entities to use this strain. For more information, please contact Northwestern Office of Innovation and New Ventures

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069932-MU-SPERM Cryo-preserved spermatozoa $437.00 / $817.00
Non-Profit / For-Profit
Aliquot Approximate quantity3
069932-MU-RESUS Litter recovered from cryo-archive $2,624.00 / $5,340.00
Non-Profit / For-Profit
Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.