Mtfmt^S204L knock-in mice have a human mutant exon 4 sequence, harboring the human S209L missense variant (transcribed at amino acid position 204 in mouse), replacing mouse exon 4 in the Mtfmt gene.

Not applicable

Heterozygous and/or homozygous mice are viable and fertile with no overt phenotype. The donating laboratory indicates that mice are born at expected Mendelian ratios from heterozygous intercrosses (n=72).

Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Littermates of all relevant genotypes.

Cat Lutz, Ph.D., The Jackson Laboratory.

Publication neither planned nor in preparation

The MtfmtS204L knock-in (KI) allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing. Guide RNAs (CTTCCAAAGACTGATTTACA, CTTTCATCGTGTTCGTCCCG) were selected to excise and replace murine exon 4 and flanking intronic DNA of the mitochondrial methionyl-tRNA formyltransferase (Mtfmt) gene on chromosome 9, with human mutant exon 4 of MTFMT, harboring the human S209L (TCA to TTA) missense variant, as well as 504bp of upstream human intronic DNA, and 100bp of downstream human intronic DNA. Mouse Mtfmt-201 transcript (ENSMUST00000074792.7) and human MTFMT-201 transcript (ENST00000589042.5) were used as references for the exon number and guide sequences. The guide RNAs, Cas9 nuclease, and double stranded plasmid donor were introduced to single cell C57BL/6J zygotes and transferred to pseudo pregnant females. Progeny were screened by DNA sequencing to identify correctly targeted pups, which were then bred to C57BL/6J mice for germline transmission. The colony was backcrossed to C57BL/6J for at least two generations.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.