Loading...

Strain Detail Sheet

Published: 05/25/2026
Revised: 05/25/2026

Strain Name:
C57BL/6J-Mecp2em8Lutzy/Mmjax
Stock Number:
076434-JAX
Citation ID:
RRID:MMRRC_076434-JAX
Other Names:
C57BL/6J-Mecp2em8Lutzy/Mmjax

Strain Information

Gene Details

Genetic Alterations
Mecp2S166S, R168X knock-in mice have an arginine replaced with a stop codon at residue 168 (R168X) in the Mecp2 gene, as well as a silent S166S mutation.
ES Cell Line
Not applicable

Strain Description

Phenotype
Heterozygous females are viable and fertile. Hemizygous males have decreased body weight, elevated Bird scores and altered open field behavior, as well as decreased survival, compared to sex-matched wildtype controls. The donating laboratory attempted to breed hemizygous males (N=2) but no litters were produced prior to the males reaching endpoint.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.

Research Applications

  • Neurobiology

Strain Origin

Submitter
Cat Lutz, Ph.D., The Jackson Laboratory.
Primary Reference
Publication neither planned nor in preparation
Strain Development
The Mecp2S166S, R168X knock-in allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing. A single guide RNA (AGGTGGTTTCTGCTCTCTCC) was used to insert an R168X mutation (AGA>TGA), as well as a silent mutation (TCC>TCT), into exon 4 of the methyl CpG binding protein 2 (Mecp2) on chromosome X. Mouse Mecp2-202 transcript (ENSMUST00000100750.9) was used as reference for the exon number and guide sequences. Guide RNA, Cas9 nuclease, and the donor template were introduced to single cell C57BL/6J zygotes and transferred to pseudo pregnant females. Progeny were screened by DNA sequencing to identify correctly targeted pups, which were then bred to C57BL/6J mice for germline transmission. The colony was backcrossed to C57BL/6J for at least two generations.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Special Considerations

heterozygous females are challenging breeders demonstrating an increase in loss of first litters as well as a significant decline in breeding performance as the females age. Progeny generated from heterozygous females bred to wildtype males were born in expected Mendelian ratios (N=83).

Health Status Report

For more information about this colony's health status contact csmmrrc@jax.org

Appearance

Coat Color
Black
Eye
Black

Breeding

MMRRC Breeding System
Sib-mating
Generation
N>2
Overall Breeding Performance
Good

Reproductive Statistics

NOTE: "Hemizygote" as used here refers to males carrying a mutation on the X Chromosome or mice of either sex carrying an inserted transgene with no homologous allele on the other chromosome.
Viability and Fertility: Female Male Comments
Homozygotes are viable: Undetermined X-linked
Homozygotes are fertile: Undetermined X-linked
Hetero/Hemizygotes are fertile: Yes No
Age Reproductive Decline: 4 to 6 months Undetermined
Average litter size
4 to 6
Recommended wean age
3 Weeks
Average Pups Weaned
4 to 6

Order Information

Availability Level

The availability level for this product has not been determined.

Conditions of Distribution

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Fees

- Products for this strain are Not Yet Available for Ordering
- If you register interest in this strain, you will be notified when it becomes available for ordering.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.