Strain Name:
C57BL/6J-MtgxR1336Btlr/Mmmh
Stock Number:
039401-MU
Citation ID:
RRID:MMRRC_039401-MU
Other Names:
R1336 (G1), C57BL/6J-MtgxR1336Btlr
Major Collection:

Gene Information

Sptbn4
Name: spectrin beta, non-erythrocytic 4
Synonyms: 1700022P15Rik, nmf261, ROSA62, 5830426A08Rik, neuroaxonal dystrophy, dyn, Spnb4, SpbIV
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 80297
Homologene: 11879
Vcan
Name: versican
Synonyms: heart defect, Cspg2, PG-M, hdf, 5430420N07Rik, DPEAAE
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 13003
HGNC: HGNC:2464
Homologene: 3228
Snx4
Name: sorting nexin 4
Synonyms: 1810036H14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 69150
VEGA: 16
Homologene: 36143
Prkca
Name: protein kinase C, alpha
Synonyms: Pkca
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 18750
HGNC: HGNC:9393
Homologene: 55679
Asah2
Name: N-acylsphingosine amidohydrolase 2
Synonyms: neutral/alkaline ceramidase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 54447
VEGA: 19
Homologene: 10310
Rif1
Name: replication timing regulatory factor 1
Synonyms: 5730435J01Rik, 6530403D07Rik, D2Ertd145e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 51869
Homologene: 41231
Ccdc141
Name: coiled-coil domain containing 141
Synonyms: 2610301F02Rik, ENSMUSG00000075261, CAMDI
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 545428
Homologene: 52149
Chsy1
Name: chondroitin sulfate synthase 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 269941
Homologene: 8950
Osbpl7
Name: oxysterol binding protein-like 7
Synonyms: 4933437E18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 71240
Homologene: 79672
Plekhm3
Name: pleckstrin homology domain containing, family M, member 3
Synonyms: 9430067K14Rik, Plekhm1l, A230102O09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 241075
Homologene: 18459
Dpy19l4
Name: dpy-19-like 4 (C. elegans)
Synonyms: Narg3, LOC381510
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 381510
Homologene: 18773
Cox16
Name: cytochrome c oxidase assembly protein 16
Synonyms: 1810020G14Rik, 1810055I05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 66272
Homologene: 9520
Sh3bgrl2
Name: SH3 domain binding glutamic acid-rich protein like 2
Synonyms: A930014C21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 212531
Homologene: 12876
Mapk3
Name: mitogen-activated protein kinase 3
Synonyms: Esrk1, p44mapk, p44erk1, Prkm3, Erk1, Mtap2k, Erk-1, p44 MAP kinase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 26417
HGNC: HGNC:6877
Homologene: 55682
Emp2
Name: epithelial membrane protein 2
Synonyms: Xmp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 13731
HGNC: HGNC:3334
Homologene: 1089
Itga9
Name: integrin alpha 9
Synonyms: D9Ertd428e, 6720458D17Rik, 2610002H11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 104099
HGNC: HGNC:6145
Homologene: 1664
Dnah17
Name: dynein, axonemal, heavy chain 17
Synonyms: 2810003K23Rik, LOC382552, Dnahcl1, Dnahc17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 69926
HGNC: HGNC:2946
Homologene: 72102
Bbs7
Name: Bardet-Biedl syndrome 7 (human)
Synonyms: 8430406N16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 71492
Homologene: 12395
Pmfbp1
Name: polyamine modulated factor 1 binding protein 1
Synonyms: 1700016D22Rik, F77
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 56523
Homologene: 23182
Stard9
Name: START domain containing 9
Synonyms: N-3 kinesin, 4831403C07Rik, Kif16a, E230025N21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 668880
Homologene: 130712
Fgl2
Name: fibrinogen-like protein 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 14190
HGNC: HGNC:3696
Homologene: 4864
Fras1
Name: Fraser extracellular matrix complex subunit 1
Synonyms: E130113P14Rik, bl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231470
Homologene: 23516
Ros1
Name: Ros1 proto-oncogene
Synonyms: c-ros, Ros-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 19886
Homologene: 2207
Fcrl6
Name: Fc receptor-like 6
Synonyms: FcRH6, moFcRH6, ENSMUSG00000070504, mIFGP6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 677296
Homologene: 88414
Papss2
Name: 3'-phosphoadenosine 5'-phosphosulfate synthase 2
Synonyms: 1810018P12Rik, Sk2, Atpsk2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 23972
VEGA: 19
HGNC: HGNC:8604
Homologene: 55840
Ogfod1
Name: 2-oxoglutarate and iron-dependent oxygenase domain containing 1
Synonyms: 4930415J21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 270086
Homologene: 41238
Uck1
Name: uridine-cytidine kinase 1
Synonyms: URK1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 22245
Homologene: 7990
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • CCTGCTGCTGCTGCTGCTGCTGCTGC to CCTGCTGCTGCTGCTGCTGCTGC, chromosome 1 at 64,937,781 bp
  • G to A, chromosome 1 at 172,599,224 bp
  • T to C, chromosome 2 at 32,259,654 bp
  • T to A, chromosome 2 at 52,078,314 bp
  • T to C, chromosome 2 at 77,014,440 bp
  • C to A, chromosome 2 at 120,673,636 bp
  • A to G, chromosome 3 at 36,604,444 bp
  • A to T, chromosome 4 at 11,276,901 bp
  • T to A, chromosome 5 at 21,373,183 bp
  • A to G, chromosome 5 at 96,707,308 bp
  • A to G, chromosome 7 at 27,417,963 bp
  • C to A, chromosome 7 at 66,125,239 bp
  • T to C, chromosome 7 at 126,763,869 bp
  • T to C, chromosome 8 at 94,058,099 bp
  • T to G, chromosome 8 at 109,530,266 bp
  • C to T, chromosome 9 at 83,577,631 bp
  • T to C, chromosome 9 at 118,689,429 bp
  • G to A, chromosome 10 at 52,168,662 bp
  • A to G, chromosome 11 at 97,052,472 bp
  • G to A, chromosome 11 at 108,192,227 bp
  • A to G, chromosome 11 at 118,043,215 bp
  • T to C, chromosome 12 at 81,472,290 bp
  • C to T, chromosome 13 at 89,693,055 bp
  • T to C, chromosome 16 at 10,284,619 bp
  • T to C, chromosome 16 at 33,280,680 bp
  • A to G, chromosome 19 at 32,044,941 bp
  • T to C, chromosome 19 at 32,638,315 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1336 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
039401-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.