Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1662Btlr/Mmmh
Stock Number:
039698-MU
Citation ID:
RRID:MMRRC_039698-MU
Other Names:
R1662 (G1), C57BL/6J-MtgxR1662Btlr
Major Collection:

Strain Information

Ifngr2
Name: interferon gamma receptor 2
Synonyms: Ifgt, Ifgr2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 15980
HGNC: HGNC:5440
Homologene: 4041
Ppp2r2a
Name: protein phosphatase 2, regulatory subunit B, alpha
Synonyms: 2410004D02Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 71978
VEGA: 14
HGNC: HGNC:9304
Homologene: 2035
Atic
Name: 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase
Synonyms: 2610509C24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 108147
HGNC: HGNC:794
Homologene: 2983
Gapdhs
Name: glyceraldehyde-3-phosphate dehydrogenase, spermatogenic
Synonyms: Gapd-s, Gapds
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 14447
Homologene: 101265
Rbpms2
Name: RNA binding protein with multiple splicing 2
Synonyms: 2400008B06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71973
VEGA: 9
Homologene: 49895
Zdbf2
Name: zinc finger, DBF-type containing 2
Synonyms: 9330107J05Rik, 4930431J08Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 73884
Homologene: 52868
Wasf1
Name: WASP family, member 1
Synonyms: WAVE-1, Scar, WAVE
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 83767
Homologene: 2920
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 63,304,249 bp
  • T to A, chromosome 1 at 71,576,127 bp
  • A to C, chromosome 1 at 88,241,618 bp
  • T to C, chromosome 1 at 119,765,058 bp
  • C to A, chromosome 1 at 133,074,631 bp
  • C to T, chromosome 1 at 134,193,636 bp
  • T to C, chromosome 1 at 164,207,888 bp
  • A to G, chromosome 1 at 178,046,986 bp
  • T to A, chromosome 1 at 189,657,771 bp
  • T to A, chromosome 2 at 66,483,459 bp
  • T to C, chromosome 2 at 69,325,289 bp
  • C to T, chromosome 2 at 71,250,979 bp
  • G to T, chromosome 2 at 112,709,273 bp
  • C to G, chromosome 2 at 121,306,408 bp
  • G to A, chromosome 2 at 127,244,937 bp
  • T to C, chromosome 2 at 136,116,760 bp
  • C to G, chromosome 2 at 158,539,270 bp
  • T to A, chromosome 3 at 38,980,779 bp
  • A to G, chromosome 3 at 40,687,772 bp
  • A to T, chromosome 3 at 59,093,617 bp
  • C to A, chromosome 3 at 60,625,172 bp
  • A to T, chromosome 3 at 64,117,130 bp
  • T to C, chromosome 3 at 88,098,401 bp
  • C to T, chromosome 3 at 96,651,738 bp
  • A to G, chromosome 3 at 133,466,852 bp
  • T to A, chromosome 4 at 53,090,251 bp
  • T to A, chromosome 4 at 126,611,682 bp
  • A to G, chromosome 5 at 37,348,750 bp
  • G to A, chromosome 5 at 86,828,122 bp
  • G to A, chromosome 5 at 103,841,057 bp
  • A to G, chromosome 5 at 103,872,045 bp
  • A to T, chromosome 5 at 105,606,757 bp
  • A to T, chromosome 5 at 106,453,499 bp
  • C to T, chromosome 5 at 114,256,894 bp
  • A to C, chromosome 5 at 121,317,245 bp
  • A to G, chromosome 5 at 127,608,979 bp
  • A to T, chromosome 6 at 4,008,066 bp
  • A to G, chromosome 6 at 89,869,590 bp
  • T to A, chromosome 6 at 124,962,438 bp
  • T to A, chromosome 7 at 12,991,246 bp
  • C to T, chromosome 7 at 30,737,002 bp
  • T to C, chromosome 7 at 41,374,449 bp
  • G to T, chromosome 7 at 67,725,321 bp
  • T to A, chromosome 7 at 102,561,898 bp
  • T to C, chromosome 7 at 121,902,328 bp
  • T to C, chromosome 7 at 127,915,566 bp
  • A to G, chromosome 7 at 138,218,107 bp
  • C to T, chromosome 8 at 5,639,666 bp
  • T to G, chromosome 8 at 44,953,164 bp
  • T to C, chromosome 8 at 70,770,606 bp
  • C to T, chromosome 8 at 71,372,647 bp
  • T to C, chromosome 8 at 72,109,779 bp
  • T to A, chromosome 8 at 123,381,550 bp
  • T to C, chromosome 9 at 13,262,772 bp
  • A to T, chromosome 9 at 44,315,432 bp
  • G to A, chromosome 9 at 44,836,670 bp
  • T to C, chromosome 9 at 65,651,042 bp
  • T to C, chromosome 9 at 70,034,377 bp
  • A to C, chromosome 9 at 110,986,683 bp
  • A to T, chromosome 9 at 123,810,548 bp
  • G to A, chromosome 10 at 40,932,045 bp
  • A to G, chromosome 10 at 107,798,357 bp
  • T to C, chromosome 10 at 127,100,078 bp
  • A to T, chromosome 10 at 127,888,612 bp
  • T to A, chromosome 11 at 60,501,701 bp
  • C to A, chromosome 11 at 99,420,824 bp
  • T to C, chromosome 11 at 116,068,673 bp
  • A to C, chromosome 12 at 18,531,966 bp
  • GTACATACATACATACATACATACATACA to GTACATACATACATACATACATACATACATACA, chromosome 12 at 40,185,261 bp
  • A to G, chromosome 13 at 21,000,113 bp
  • A to G, chromosome 13 at 59,716,628 bp
  • T to C, chromosome 13 at 59,799,903 bp
  • A to T, chromosome 14 at 12,207,357 bp
  • T to A, chromosome 14 at 14,407,880 bp
  • T to C, chromosome 14 at 28,518,343 bp
  • T to C, chromosome 14 at 31,666,790 bp
  • T to C, chromosome 14 at 53,102,072 bp
  • T to C, chromosome 14 at 55,973,116 bp
  • T to A, chromosome 14 at 65,028,880 bp
  • T to C, chromosome 14 at 67,016,603 bp
  • G to T, chromosome 15 at 86,031,062 bp
  • T to C, chromosome 16 at 59,110,604 bp
  • T to A, chromosome 16 at 91,560,596 bp
  • C to A, chromosome 17 at 23,834,811 bp
  • G to T, chromosome 17 at 23,972,832 bp
  • G to T, chromosome 17 at 37,575,273 bp
  • A to T, chromosome 17 at 86,829,027 bp
  • A to G, chromosome 18 at 71,420,338 bp
  • A to C, chromosome 19 at 4,328,212 bp
  • A to T, chromosome 19 at 5,551,639 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1662 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039698-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.