Strain Name:
C57BL/6J-MtgxR1662Btlr/Mmmh
Stock Number:
039698-MU
Citation ID:
RRID:MMRRC_039698-MU
Other Names:
R1662 (G1), C57BL/6J-MtgxR1662Btlr
Major Collection:

Gene Information

Ifngr2
Name: interferon gamma receptor 2
Synonyms: Ifgr2, Ifgt
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 15980
HGNC: HGNC:5440
Homologene: 4041
Ppp2r2a
Name: protein phosphatase 2, regulatory subunit B, alpha
Synonyms: 2410004D02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 71978
VEGA: 14
HGNC: HGNC:9304
Homologene: 2035
Atic
Name: 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase
Synonyms: 2610509C24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 108147
HGNC: HGNC:794
Homologene: 2983
Gapdhs
Name: glyceraldehyde-3-phosphate dehydrogenase, spermatogenic
Synonyms: Gapds, Gapd-s
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 14447
Homologene: 101265
Rbpms2
Name: RNA binding protein with multiple splicing 2
Synonyms: 2400008B06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 71973
VEGA: 9
Homologene: 49895
Zdbf2
Name: zinc finger, DBF-type containing 2
Synonyms: 9330107J05Rik, 4930431J08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 73884
Homologene: 52868
Wasf1
Name: WAS protein family, member 1
Synonyms: Scar, WAVE, WAVE-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 83767
Homologene: 2920
Kat8
Name: K(lysine) acetyltransferase 8
Synonyms: MOF, 5830450F21Rik, Myst1, D7Ertd629e, 2010203C02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 67773
Homologene: 41676
Aff1
Name: AF4/FMR2 family, member 1
Synonyms: Mllt2h, Af4, 9630032B01Rik, Rob
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 17355
HGNC: HGNC:7135
Homologene: 4340
Tut7
Name: terminal uridylyl transferase 7
Synonyms: Zcchc6, Tent3b, 6030448M23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 214290
VEGA: 13
Homologene: 51941
Ptprg
Name: protein tyrosine phosphatase, receptor type, G
Synonyms: RPTPgamma, 5430405N12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 19270
HGNC: HGNC:9671
Homologene: 2129
Kmt2a
Name: lysine (K)-specific methyltransferase 2A
Synonyms: Mll, Mll1, All1, HTRX1, ALL-1, trithorax Drosophila, Cxxc7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 214162
HGNC: HGNC:7132
Homologene: 4338
Ints9
Name: integrator complex subunit 9
Synonyms: D14Ertd231e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 210925
VEGA: 14
Homologene: 10096
Os9
Name: amplified in osteosarcoma
Synonyms: 4632413K17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 216440
VEGA: 10
Homologene: 31409
Tet2
Name: tet methylcytosine dioxygenase 2
Synonyms: Ayu17-449, E130014J05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 214133
Homologene: 49498
Cenpf
Name: centromere protein F
Synonyms: 6530404A22Rik, mitosin, Lek1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 108000
HGNC: HGNC:1857
Homologene: 22969
Abca1
Name: ATP-binding cassette, sub-family A (ABC1), member 1
Synonyms: ABC1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 11303
HGNC: HGNC:29
Homologene: 21130
Unc13d
Name: unc-13 homolog D
Synonyms: Jinx, 2610108D09Rik, Munc13-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 70450
Homologene: 26714
Mbnl1
Name: muscleblind like splicing factor 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 56758
HGNC: HGNC:6923
Homologene: 23186
Iqgap3
Name: IQ motif containing GTPase activating protein 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 404710
Homologene: 26400
Dcc
Name: deleted in colorectal carcinoma
Synonyms: Igdcc1, C030036D22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 13176
HGNC: HGNC:2701
Homologene: 21081
C2cd2l
Name: C2 calcium-dependent domain containing 2-like
Synonyms: Tmem24, 1300006O23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 71764
VEGA: 9
Homologene: 8876
Ttc23
Name: tetratricopeptide repeat domain 23
Synonyms: 1600012K10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 67009
Homologene: 11289
Dync1i2
Name: dynein cytoplasmic 1 intermediate chain 2
Synonyms: Dncic2, 3110079H08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 13427
HGNC: HGNC:2964
Homologene: 37921
Fat1
Name: FAT atypical cadherin 1
Synonyms: mFat1, 2310038E12Rik, Fath
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 14107
HGNC: HGNC:3595
Homologene: 66302
Cops7a
Name: COP9 signalosome subunit 7A
Synonyms: D6Ertd35e, COP9 complex S7a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 26894
Homologene: 22685
Tcf25
Name: transcription factor 25 (basic helix-loop-helix)
Synonyms: 1100001J13Rik, Nulp1, D8Ertd325e, 1810041K11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 66855
Homologene: 5701
Slc15a4
Name: solute carrier family 15, member 4
Synonyms: C130069N12Rik, PTR4, PHT1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 100561
Homologene: 26432
Ythdc1
Name: YTH domain containing 1
Synonyms: A730098D12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 231386
Homologene: 15796
Hectd4
Name: HECT domain E3 ubiquitin protein ligase 4
Synonyms: Gm15800
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 269700
Homologene: 28297
Kdm2a
Name: lysine (K)-specific demethylase 2A
Synonyms: 5530401A10Rik, Jhdm1a, Fbl7, lalina, Gm4560, Fbxl11, Cxxc8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 225876
Homologene: 56564
Ptpn4
Name: protein tyrosine phosphatase, non-receptor type 4
Synonyms: hPTP-MEG, PTPMEG, TEP, protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte), TEP/mPTPMEG, testis-enriched phosphatase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 19258
HGNC: HGNC:9656
Homologene: 2120
Wnt5a
Name: wingless-type MMTV integration site family, member 5A
Synonyms: 8030457G12Rik, Wnt-5a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 22418
Homologene: 20720
5730507C01Rik
Name: RIKEN cDNA 5730507C01 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 236366
VEGA: 12
Lrrc8c
Name: leucine rich repeat containing 8 family, member C
Synonyms: E430036I04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 100604
Homologene: 12997
Klhl8
Name: kelch-like 8
Synonyms: 2310001P09Rik, D5Ertd431e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 246293
Homologene: 10819
Myo15
Name: myosin XV
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 17910
HGNC: HGNC:7594
Homologene: 56504
Med12l
Name: mediator complex subunit 12-like
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 329650
Homologene: 43143
Celsr1
Name: cadherin, EGF LAG seven-pass G-type receptor 1
Synonyms: Scy, crash, Adgrc1, Crsh
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 12614
VEGA: 15
HGNC: HGNC:1850
Homologene: 7665
Foxn4
Name: forkhead box N4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 116810
Homologene: 17526
F5
Name: coagulation factor V
Synonyms: Cf5, Cf-5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 14067
HGNC: HGNC:3542
Homologene: 104
Intu
Name: inturned planar cell polarity protein
Synonyms: Pdzd6, 9230116I04Rik, 9430087H23Rik, Pdzk6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 380614
Homologene: 41059
Evc2
Name: EvC ciliary complex subunit 2
Synonyms: Ellis van Creveld syndrome 2, limbin, Lbn
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 68525
Homologene: 17117
Gcnt3
Name: glucosaminyl (N-acetyl) transferase 3, mucin type
Synonyms: 2210021I22Rik, 2010013H22Rik, 2210401J11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 72077
VEGA: 9
HGNC: HGNC:4205
Homologene: 20993
Fat4
Name: FAT atypical cadherin 4
Synonyms: 6030410K14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 329628
Homologene: 14377
Gm4934
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
Ryr3
Name: ryanodine receptor 3
Synonyms: calcium release channel isoform 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 20192
Homologene: 68151
Pik3r2
Name: phosphoinositide-3-kinase regulatory subunit 2
Synonyms: p85beta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 18709
HGNC: HGNC:8980
Homologene: 3687
Pak7
Name: p21 (RAC1) activated kinase 7
Synonyms: 2900083L08Rik, Pak5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 241656
Homologene: 22211
Vmn2r2
Name: vomeronasal 2, receptor 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 100125586
Homologene: 129753
Abcb11
Name: ATP-binding cassette, sub-family B (MDR/TAP), member 11
Synonyms: sister of P-glycoprotein, Lith1, Bsep, PFIC2, ABC16, PGY4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 27413
HGNC: HGNC:42
Homologene: 74509
Mroh2a
Name: maestro heat-like repeat family member 2A
Synonyms: ENSMUSG00000044873, Heatr7b1, OTTMUSG00000020804
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 100040766
Homologene: 85300
Scn9a
Name: sodium channel, voltage-gated, type IX, alpha
Synonyms: PN1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 20274
Homologene: 2237
Epas1
Name: endothelial PAS domain protein 1
Synonyms: bHLHe73, HIF2A, HLF, MOP2, HRF, HIF-2alpha, hypoxia inducible transcription factor 2alpha, Hif like protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 13819
VEGA: 17
HGNC: HGNC:3374
Homologene: 1095
Mybph
Name: myosin binding protein H
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 53311
HGNC: HGNC:7552
Homologene: 3661
Otogl
Name: otogelin-like
Synonyms: Gm6924
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 628870
Homologene: 46008
Gm16432
Name: predicted gene 16432
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
Map1a
Name: microtubule-associated protein 1 A
Synonyms: Mtap1, 6330416M19Rik, Mtap-1, Mtap1a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 17754
HGNC: HGNC:6835
Homologene: 1778
Olfr721-ps1
Name: olfactory receptor 721, pseudogene 1
Synonyms: MOR274-4_i, GA_x6K02T2PLTE-6793523-6794528, MOR274-3P
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 257982
Olfr113
Name: olfactory receptor 113
Synonyms: MOR218-9, GA_x6K02T2PSCP-2034880-2033942
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 258286
Gm1840
Name: predicted gene 1840
Synonyms: LOC233995
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 669429
Itga10
Name: integrin, alpha 10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 213119
HGNC: HGNC:6135
Homologene: 2697
Arhgap40
Name: Rho GTPase activating protein 40
Synonyms: Gm14203
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 545481
Homologene: 53500
Aoah
Name: acyloxyacyl hydrolase
Synonyms: 4930433E13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 27052
VEGA: 13
HGNC: HGNC:548
Homologene: 1238
Scnn1b
Name: sodium channel, nonvoltage-gated 1 beta
Synonyms: ENaC beta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 20277
Homologene: 133555
Barhl2
Name: BarH like homeobox 2
Synonyms: MBH1, E130309B19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 104382
HGNC: HGNC:954
Homologene: 10572
Rdh7
Name: retinol dehydrogenase 7
Synonyms: CRAD2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 54150
Homologene: 137324
Krt12
Name: keratin 12
Synonyms: Krt1-12, K12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 268482
HGNC: HGNC:6414
Homologene: 188
Tcerg1l
Name: transcription elongation regulator 1-like
Synonyms: 5730476P14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 70571
Homologene: 52165
Rtp3
Name: receptor transporter protein 3
Synonyms: Tmem7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 235636
Homologene: 135957
Cxcr6
Name: chemokine (C-X-C motif) receptor 6
Synonyms: BONZO, STRL33
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 80901
VEGA: 9
Homologene: 38197
Cma2
Name: chymase 2, mast cell
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 545055
VEGA: 14
Homologene: 115745
Vmn1r43
Name: vomeronasal 1 receptor 43
Synonyms: V1ra5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 113847
Homologene: 130651
Pik3c2b
Name: phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta
Synonyms: PI3K-C2beta, C330011J12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 240752
HGNC: HGNC:8972
Homologene: 20582
Prss33
Name: protease, serine 33
Synonyms: mT6, Eos, tryptase-6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 353130
Homologene: 77185
Olfr193
Name: olfactory receptor 193
Synonyms: GA_x54KRFPKG5P-55338697-55337768, MOR113-7P, MOR113-7P, MOR183-7P, Olfr1540-ps1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 257972
Homologene: 128162
AI987944
Name: expressed sequence AI987944
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 233168
Ocel1
Name: occludin/ELL domain containing 1
Synonyms: 9430098E02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 77090
Homologene: 11597
Lsmem1
Name: leucine-rich single-pass membrane protein 1
Synonyms: Gm889, LOC380755
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 380755
VEGA: 12
Homologene: 18800
Ovol1
Name: ovo like zinc finger 1
Synonyms: movo1, Ovo1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 18426
VEGA: 19
HGNC: HGNC:8525
Homologene: 3354
Ccdc82
Name: coiled-coil domain containing 82
Synonyms: 2310043N13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 66396
VEGA: 9
Homologene: 11678
Prss30
Name: protease, serine 30
Synonyms: Tmprss8, 2010015P21Rik, Disp, Disp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 30943
Homologene: 88826
Btd
Name: biotinidase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 26363
HGNC: HGNC:1122
Homologene: 37255
5730409E04Rik
Name: RIKEN cDNA 5730409E04Rik gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 230757
Homologene: 17566
Ciao1
Name: cytosolic iron-sulfur protein assembly 1
Synonyms: Wdr39
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 26371
Homologene: 55850
Gng11
Name: guanine nucleotide binding protein (G protein), gamma 11
Synonyms: 0610037B21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 66066
HGNC: HGNC:4403
Homologene: 3045
Slc27a5
Name: solute carrier family 27 (fatty acid transporter), member 5
Synonyms: FACVL3, FATP5, VLCSH2, VLCS-H2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 26459
Homologene: 7596
Trim21
Name: tripartite motif-containing 21
Synonyms: Ro52, Ssa1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 20821
Homologene: 2365
Olfr374
Name: olfactory receptor 374
Synonyms: MOR130-1, GA_x6K02T2NUPS-241490-242431
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 258335
Homologene: 131127
Trav9n-1
Name: T cell receptor alpha variable 9N-1
Synonyms: Gm5074
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 279872
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 63,304,249 bp
  • T to A, chromosome 1 at 71,576,127 bp
  • A to C, chromosome 1 at 88,241,618 bp
  • T to C, chromosome 1 at 119,765,058 bp
  • C to A, chromosome 1 at 133,074,631 bp
  • C to T, chromosome 1 at 134,193,636 bp
  • T to C, chromosome 1 at 164,207,888 bp
  • A to G, chromosome 1 at 178,046,986 bp
  • T to A, chromosome 1 at 189,657,771 bp
  • T to A, chromosome 2 at 66,483,459 bp
  • T to C, chromosome 2 at 69,325,289 bp
  • C to T, chromosome 2 at 71,250,979 bp
  • G to T, chromosome 2 at 112,709,273 bp
  • C to G, chromosome 2 at 121,306,408 bp
  • G to A, chromosome 2 at 127,244,937 bp
  • T to C, chromosome 2 at 136,116,760 bp
  • C to G, chromosome 2 at 158,539,270 bp
  • T to A, chromosome 3 at 38,980,779 bp
  • A to G, chromosome 3 at 40,687,772 bp
  • A to T, chromosome 3 at 59,093,617 bp
  • C to A, chromosome 3 at 60,625,172 bp
  • A to T, chromosome 3 at 64,117,130 bp
  • T to C, chromosome 3 at 88,098,401 bp
  • C to T, chromosome 3 at 96,651,738 bp
  • A to G, chromosome 3 at 133,466,852 bp
  • T to A, chromosome 4 at 53,090,251 bp
  • T to A, chromosome 4 at 126,611,682 bp
  • A to G, chromosome 5 at 37,348,750 bp
  • G to A, chromosome 5 at 86,828,122 bp
  • G to A, chromosome 5 at 103,841,057 bp
  • A to G, chromosome 5 at 103,872,045 bp
  • A to T, chromosome 5 at 105,606,757 bp
  • A to T, chromosome 5 at 106,453,499 bp
  • C to T, chromosome 5 at 114,256,894 bp
  • A to C, chromosome 5 at 121,317,245 bp
  • A to G, chromosome 5 at 127,608,979 bp
  • A to T, chromosome 6 at 4,008,066 bp
  • A to G, chromosome 6 at 89,869,590 bp
  • T to A, chromosome 6 at 124,962,438 bp
  • T to A, chromosome 7 at 12,991,246 bp
  • C to T, chromosome 7 at 30,737,002 bp
  • T to C, chromosome 7 at 41,374,449 bp
  • G to T, chromosome 7 at 67,725,321 bp
  • T to A, chromosome 7 at 102,561,898 bp
  • T to C, chromosome 7 at 121,902,328 bp
  • T to C, chromosome 7 at 127,915,566 bp
  • A to G, chromosome 7 at 138,218,107 bp
  • C to T, chromosome 8 at 5,639,666 bp
  • T to G, chromosome 8 at 44,953,164 bp
  • T to C, chromosome 8 at 70,770,606 bp
  • C to T, chromosome 8 at 71,372,647 bp
  • T to C, chromosome 8 at 72,109,779 bp
  • T to A, chromosome 8 at 123,381,550 bp
  • T to C, chromosome 9 at 13,262,772 bp
  • A to T, chromosome 9 at 44,315,432 bp
  • G to A, chromosome 9 at 44,836,670 bp
  • T to C, chromosome 9 at 65,651,042 bp
  • T to C, chromosome 9 at 70,034,377 bp
  • A to C, chromosome 9 at 110,986,683 bp
  • A to T, chromosome 9 at 123,810,548 bp
  • G to A, chromosome 10 at 40,932,045 bp
  • A to G, chromosome 10 at 107,798,357 bp
  • T to C, chromosome 10 at 127,100,078 bp
  • A to T, chromosome 10 at 127,888,612 bp
  • T to A, chromosome 11 at 60,501,701 bp
  • C to A, chromosome 11 at 99,420,824 bp
  • T to C, chromosome 11 at 116,068,673 bp
  • A to C, chromosome 12 at 18,531,966 bp
  • GTACATACATACATACATACATACATACA to GTACATACATACATACATACATACATACATACA, chromosome 12 at 40,185,261 bp
  • A to G, chromosome 13 at 21,000,113 bp
  • A to G, chromosome 13 at 59,716,628 bp
  • T to C, chromosome 13 at 59,799,903 bp
  • A to T, chromosome 14 at 12,207,357 bp
  • T to A, chromosome 14 at 14,407,880 bp
  • T to C, chromosome 14 at 28,518,343 bp
  • T to C, chromosome 14 at 31,666,790 bp
  • T to C, chromosome 14 at 53,102,072 bp
  • T to C, chromosome 14 at 55,973,116 bp
  • T to A, chromosome 14 at 65,028,880 bp
  • T to C, chromosome 14 at 67,016,603 bp
  • G to T, chromosome 15 at 86,031,062 bp
  • T to C, chromosome 16 at 59,110,604 bp
  • T to A, chromosome 16 at 91,560,596 bp
  • C to A, chromosome 17 at 23,834,811 bp
  • G to T, chromosome 17 at 23,972,832 bp
  • G to T, chromosome 17 at 37,575,273 bp
  • A to T, chromosome 17 at 86,829,027 bp
  • A to G, chromosome 18 at 71,420,338 bp
  • A to C, chromosome 19 at 4,328,212 bp
  • A to T, chromosome 19 at 5,551,639 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1662 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
039698-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter1; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

3 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.