Strain Name:
C57BL/6J-MtgxR4389Btlr/Mmmh
Stock Number:
041126-MU
Citation ID:
RRID:MMRRC_041126-MU
Other Names:
R4389 (G1), C57BL/6J-MtgxR4389Btlr
Major Collection:

Gene Information

Lhx3
Name: LIM homeobox protein 3
Synonyms: Lim3, mLim-3, P-LIM
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 16871
HGNC: HGNC:6595
Homologene: 7814
Nptn
Name: neuroplastin
Synonyms: Sdfr1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 20320
Homologene: 105617
Ercc6
Name: excision repair cross-complementing rodent repair deficiency, complementation group 6
Synonyms: CS group B correcting gene, CSB, C130058G22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 319955
VEGA: 14
HGNC: HGNC:3438
Homologene: 133552
Orc2
Name: origin recognition complex, subunit 2
Synonyms: Orc2l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 18393
HGNC: HGNC:8488
Homologene: 4512
Ctps
Name: cytidine 5'-triphosphate synthase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 51797
HGNC: HGNC:2519
Homologene: 20446
Cd209b
Name: CD209b antigen
Synonyms: 1810030I22Rik, mSIGNR1, SIGNR1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 69165
HGNC: HGNC:1641
Homologene: 84858
Abca13
Name: ATP-binding cassette, sub-family A (ABC1), member 13
Synonyms: A930002G16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 268379
Homologene: 27991
Kng2
Name: kininogen 2
Synonyms: Kininogen-II
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 385643
HGNC: HGNC:6383
Homologene: 88343
Cd109
Name: CD109 antigen
Synonyms: Gov platelet alloantigens, 9930012E15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235505
Homologene: 25183
Adprm
Name: ADP-ribose/CDP-alcohol diphosphatase, manganese dependent
Synonyms: 2310004I24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 66358
Homologene: 10632
Tec
Name: tec protein tyrosine kinase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 21682
Homologene: 1302
Slc13a1
Name: solute carrier family 13 (sodium/sulfate symporters), member 1
Synonyms: NaSi-1, Nas1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 55961
Homologene: 31893
Olfr262
Name: olfactory receptor 262
Synonyms: MOR214-1, GA_x6K02T2N4A9-18144-19082, MOR214-9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 258683
Vmn1r66
Name: vomeronasal 1 receptor 66
Synonyms: V1re11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 171264
Nlrp4e
Name: NLR family, pyrin domain containing 4E
Synonyms: 4930406H16Rik, Nalp-epsilon, Nalp4e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 446099
Homologene: 75315
Gzma
Name: granzyme A
Synonyms: Hanukah factor, serine esterase 1, Hf, Ctla-3, TSP1, SE1, H factor, Ctla3, BLT esterase, TSP-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 14938
VEGA: 13
HGNC: HGNC:4708
Homologene: 21237
Mtfr1l
Name: mitochondrial fission regulator 1-like
Synonyms: Fam54b, 2410166I05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 76824
Homologene: 10472
Rpl7a-ps3
Name: ribosomal protein L7A, pseudogene 3
Synonyms: Gm5044
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 268795
VEGA: 15
Zfp189
Name: zinc finger protein 189
Synonyms: C430015I23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230162
Homologene: 20737
Ttll2
Name: tubulin tyrosine ligase-like family, member 2
Synonyms: EG625850
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 100216474
VEGA: 17
Homologene: 12917
Ndufb4
Name: NADH:ubiquinone oxidoreductase subunit B4
Synonyms: 0610006N12Rik, 1300010H20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 68194
HGNC: HGNC:7699
Homologene: 3342
Pcdha4
Name: protocadherin alpha 4
Synonyms: Crnr1, Cnr1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 12936
HGNC: HGNC:8670
Homologene: 130626
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 58,474,861 bp
  • C to T, chromosome 2 at 26,201,090 bp
  • A to G, chromosome 4 at 49,529,934 bp
  • T to C, chromosome 4 at 120,558,790 bp
  • T to C, chromosome 4 at 134,532,642 bp
  • A to G, chromosome 5 at 72,782,007 bp
  • A to T, chromosome 6 at 24,092,398 bp
  • A to T, chromosome 7 at 10,274,788 bp
  • A to G, chromosome 7 at 23,321,227 bp
  • A to G, chromosome 8 at 3,925,960 bp
  • A to G, chromosome 9 at 58,643,772 bp
  • CATTTATTTATTTATTTATTTATTTATTTATTTAT to CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT, chromosome 9 at 78,712,500 bp
  • T to A, chromosome 10 at 92,967,500 bp
  • A to C, chromosome 11 at 9,297,878 bp
  • C to T, chromosome 11 at 67,038,193 bp
  • G to T, chromosome 13 at 113,098,388 bp
  • T to A, chromosome 14 at 32,574,908 bp
  • G to A, chromosome 15 at 36,308,283 bp
  • T to C, chromosome 16 at 23,024,868 bp
  • T to C, chromosome 16 at 37,647,670 bp
  • T to A, chromosome 17 at 7,351,200 bp
  • T to C, chromosome 18 at 36,954,789 bp
  • A to G, chromosome 19 at 12,241,139 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4389 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
041126-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.