Loading Mouse GIF
Loading...

Strain Name:
B6;129S6-Rr34tm1.1Lap/Mmnc
Stock Number:
042088-UNC
Citation ID:
RRID:MMRRC_042088-UNC
Other Names:
mm77 deletion, mm77 knockout

Strain Information

Rr34tm1.1Lap
Name: regulatory region 34; targeted mutation 1.1, Len Pennacchio
Synonyms: mm77tm1.1Lap
Type: Allele
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Targeted Mutation
Rr34
Name: regulatory region 34
Synonyms: mm77
Type: DNA Segment
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Targeted Mutation
Genetic Alterations
Deletion of a 2,517-bp segment on mouse chromosome 5, identified as a heart enhancer (referred to as "mm77"). 
Genotype Determination
  • Genotyping Protocol(s)
  • Center protocol and contact for technical support will be shipped with mice.
  • ES Cell Line
    W4 derived from 129S6/SvEvTac
    Phenotype

    Homozygous: Mice homozygous for mm77 enhancer deletion are born at normal Mendelian ratios and show no gross abnormalities or overt impairments of health. However, they show a 75-80% reduction in Myl2 RNA expression compared to wild-type levels at E11.5 and in adults, as well as a ~70% reduction in MyL2 cardiac protein level. Nppa and Nppb genes, whose upregulation is a common biomarker of heart failure, are upregulated in adult mm 77 deletion mice. Histological analysis of the homozygous null mice shows myocardiocyte disarray and karyomegaly and a modest but significant decrease in fractional shortening as measured by echocardiography.

    Heterozygous: Mice heterozygous for mm77 enhancer deletion are normal and show no gross abnormalities or overt impairments of health. Myl2 RNA expression is reduced by ~35% in heterozygotes compared to wild type litter mates. Protein levels and cardiac function have not been assessed in heterozygotes to date.

    Mammalian Phenotype Terms
    Allelic Composition: (Genetic Background: )

    Strain GQC Summary
    Gene Specific Genotyping:

    To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

    Background Genetic Quality:

    The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

    Suggested Control Mice
    Littermates of all relevant genotypes.
    • Cardiovascular
    • Models for Human Disease
    • Research Tools
    Submitter
    Axel Visel, Ph.D., Lawrence Berkeley National Laboratory.
    Len Pennacchio, Ph.D., Lawrence Berkeley National Laboratory.
    Strain Development
    Homology arms were generated by PCR amplification from 129Sv mouse genomic DNA and cloned into a targeting vector containing a neo cassette flanked by loxP sites. The vector was electroporated into mouse ES cells which were then screened for proper integration. Correctly targeted ES cells were transfected with a plasmid driving a Cre recombinase to remove the Neo cassette leaving a single loxP site in place of the mm77 enhancer. Targeted ES clones were injected into C57BL/6 blastocysts and chimeric males were bred to C57BL/6 females. Agouti offspring were tested for germline transmission of the targeted allele by PCR with primers specific to vector sequence replacing the enhancer (Bam5'-F: TTGGCTGGACGTAAACTCCTCTTCAG) and genomic sequence outside short arm (mm77.rev: TACCGTTTCCCCCAGATCTGGAGAGT). Heterozygous animals were then inter-crossed to obtain homozygous deletion animals for the mouse mm77 locus. Offspring were genotyped with primers covering the mm77 deleted interval (mm77 Genotyping primers, wt 339 bp (fwd/rev2); del 139 bp (fwd2/rev2) mm77.fwd: TGTTCAAGGTAGTCCTGCGTGCCCAT (within deleted region) mm77 fwd2: GGGTTCCAAGGATTTAGACTTTCCTAGA mm77 rev2: TGCGTTGTCTCACTAGTCTCTTCTGGAGG).

    Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.

    Colony and Husbandry Information

    Colony Surveillance Program and Current Health Reports

    Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc_health@med.unc.edu.
    Coat Color
    Agouti and black
    MMRRC Breeding System
    Sib-mating
    Generation
    F5
    Overall Breeding Performance
    Good
    Viability and Fertility: Female Male Comments
    Homozygotes are viable: Yes Yes
    Homozygotes are fertile: Yes Yes
    Heterozygotes are fertile: Yes Yes
    Age Reproductive Decline: Undetermined Undetermined
    Bred to Homozygosity
    No
    Average litter size
    4-6
    Recommended wean age
    3 weeks

    Order Information

    Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

    Cryopreserved material may be available upon request, please inquire to mmrrc@med.unc.edu for more information.

    Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

    The submitter or their institution limits the distribution to non-profit institutions only.

    Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

    Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
    MMRRC Item # Description Distribution Fee / Unit (US $)
    *Shipping & Handling not included*
    Units Notes
    042088-UNC-EMBRYO Cryo-preserved embryos $1,718.00 / Non-Profit Aliquot Approximate quantity2 : 20-40 embryos / aliquot
    042088-UNC-SPERM Cryo-preserved spermatozoa $572.00 / Non-Profit Aliquot Approximate quantity3
    042088-UNC-RESUS Litter recovered from cryo-archive $3,566.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.

    1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

    2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

    3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

    4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

    To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.