intragenic deletion

Phenotyping data may be available at mousephenotype.org.

The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.

Littermates of all relevant genotypes.

Stephen Murray, Ph.D., The Jackson Laboratory.

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTGTGGGAACTATTACTGGG, CTCAGTTTAACTTTTCCAGG, GGTTACAGAGGGTTAACTGA and GCAGCTAATACATCATTAAA, which resulted in a total of 611 bp deletion beginning at Chromosome 9 positive strand position 65,999,223 bp for 48 bp where there is an endogenous 3 bp retention (GGA) followed by 563 bp deletion ending after 65,999,836 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001221266 (exon 6) and 459 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 97 and early truncation 29 amino acids later.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.