Strain Name:
C57BL/6NJ-Las1lem1(IMPC)J/Mmjax
Stock Number:
043714-JAX
Citation ID:
RRID:MMRRC_043714-JAX
Major Collection:

Gene Information

Allele Symbol: Las1lem1(IMPC)J (Mus musculus (mouse))
Name: endonuclease-mediated mutation 1, Jackson
Alteration at locus: Targeted Mutation
Monarch Initiative (Disease and Phenotype Associations): MGI:6107678
Gene Symbol: Las1l (Mus musculus (mouse))
Name: LAS1-like (S. cerevisiae)
Synonyms: 5830482G23Rik, 1810030A06Rik
Chromosome: X
Alteration at locus: Targeted Mutation
Monarch Initiative (Disease and Phenotype Associations): MGI:1923380
Genetic Alterations
intragenic deletion
ES Cell Line
N/A
MeSH Terms
    Strain Development
    This allele was generated at The Jackson Laboratory by injecting Cas9 RNA, 4 guide sequences TGAAATAGTATGTTCCACGA, CCTTACCCCATGACCTACTT, GCTGACACCAAGCATAAGAA and CCCACCCCAACATTTACTAA, and a single strand oligo containing a loxP flanked exon 3 sequence. The integration of sequence from this single stranded oligo resulted in the insertion of loxP sites flanking ENSMUSE00001265601 (exon 3) starting at Chromosome X negative strand position 95,955,321 bp and ending after 95,955,101. There are no additional changes other than the insertion of the 2 loxP sites.
    Suggested Control Mice
    C57BL/6NJ or wild-type from colony
    Donor
    Stephen Murray, Ph.D., The Jackson Laboratory.

    Colony and Husbandry Informationon

    Mice derived from requested cell lines via Microinjection services will be pathogen tested prior to delivery of mice and health reports will be provided. If you require additional health status information prior to requesting microinjection please email csmmrrc@jax.org.
    Coat Color
    black
    Generation
    N2F2
    Overall Breeding Performance
    Undetermined
    Viability and Fertility: Female Male Comments
    Homozygotes are viable: Undetermined Undetermined Undetermined
    Homozygotes are fertile: Undetermined Undetermined Undetermined
    Heterozygotes are fertile: Undetermined Undetermined Undetermined
    Age Reproductive Decline: Undetermined Undetermined

    Order Request Information

    The availability level for this product has not been determined.

    Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

    - Products for this strain are Not Yet Available for Ordering
    - If you register interest in this strain, you will be notified when it becomes available for ordering.

    To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.