Register New MMRRC Account
Reset Password
Register for New Mouse Models
Click Here for Additional Contact Information
Availability & Fees Order this Strain
To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.
The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.
Embryo injections were done with one guide RNA. The target sequence for the guide RNA was GCGACTTGCGCATCCATGTG (cgg), which includes the start codon for Foxe3. The following primers were used to amplify a 1.2-kb H2B-mCherry-T2A donor (template plasmid from the laboratory of Richard Behringer) for insertion, in-frame, at the ATG codon:
Sense primer: 5’-CCGCATCCCTAGGACCCCCACCCCCACCCCCCGCAC ATGCCAGA GCCAGCGAAG TCTGCTCCCG
Antisense primer: 5’-CAAGGCCGGGAAGCCCGAGAAAGCGACTTGCGCATCCAT ACCAGGTCCTGGGTTCTCTTCTACGTCTCCACA
The CRISPR guide RNA, Cas9 mRNA, and donor DNA were microinjected into the cytoplasm of FVB zygotes. The goal was to generate transgenic mice that express both Foxe3 and a reporter transgene (nuclear-localized mCherry) driven by the endogenous Foxe3 promoter. Progeny were screened by PCR using primers 334 (CAATGAGCGCGATGTATGAGTAGG) and 437 (catcacctcccacaacgaggacta) to look for targeted integration of the donor DNA, and using the Sense and Antisense primers described above to look for insertion of the full-length donor. One founder male was mated to FVB females, and the F1 progeny were screened by PCR amplifications of tail DNA using primers 334+437. The PCR bands were sequenced. Sibling F1 mice with identical insertions were mated to generate F2 mice. None of the F2 mice had cataracts or microphthalmia. The F2 mice were screened for homozygosity by PCR-based genotyping (334+437 positive; 343 [gagtgtgctgaatgggtgtgtttg] +334 positive for a single band at 1.8 kb, indicative of a 1.2 kb insertion). The PCR bands were sequenced. Homozygous brother/sister matings were used to maintain the line. Homozygous males were used for sperm cryopreservation.
Note: The FVB strain used during the development was transferred from the NIH to the donor's institution >34 years prior, thus establishing the substrain FVB/NOve.
Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.
Colony Surveillance Program and Current Health Reports
When this strain becomes available, Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.
Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.
The submitter or their institution limits the distribution to non-profit institutions only.
To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.
We use cookies to improve your experience, personalize content, and analyze traffic. By using this site, you agree to our use of cookies. For more details, please visit our Privacy Policy.