Loading Mouse GIF
Loading...

Strain Name:
FVB/NOve-Foxe3em2Ove/Mmmh
Stock Number:
065573-MU
Citation ID:
RRID:MMRRC_065573-MU
Other Names:
FoxE3/mCherry insert

Strain Information

Foxe3em2Ove
Name: forkhead box E3; endonuclease-mediated mutation 2, Paul Overbeek
Type: Allele
Species: Multi-species
Chromosome: 4
Foxe3
Name: forkhead box E3
Synonyms: FREAC8, rct
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 30923
HGNC: HGNC:3808
Homologene: 32145
mCherry
Name: red fluorescent fluorophore, mCherry
Type: Gene
Species: Discosoma sp. (mushroom coral)
Chromosome:
H2BC11
Name: H2B clustered histone 11
Type: Gene
Species: Homo sapiens (human)
Chromosome: 6
Genetic Alterations
An H2B-mCherry-T2A reporter construct was inserted, in-frame, following the Foxe3 start codon.

Specific sequence details as provided by the Donor are available; please contact the MMRRC to request files "65573_Data1.pdf" and "65573_65574_Data.pdf"
Genotype Determination
Phenotype
Homozygotes: Lenses are normal. FACS analysis verified the expression of the mCherry reporter in embryonic lens cells. The reporter gene can be used to purify newly induced lens cells for detailed molecular studies.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
  • Lens induction
Submitter
Paul Overbeek, Ph.D., Baylor College of Medicine.
Strain Development

Embryo injections were done with one guide RNA. The target sequence for the guide RNA was GCGACTTGCGCATCCATGTG (cgg), which includes the start codon for Foxe3. The following primers were used to amplify a 1.2-kb H2B-mCherry-T2A donor (template plasmid from the laboratory of Richard Behringer) for insertion, in-frame, at the ATG codon:

Sense primer: 5’-CCGCATCCCTAGGACCCCCACCCCCACCCCCCGCAC ATGCCAGA GCCAGCGAAG TCTGCTCCCG

Antisense primer: 5’-CAAGGCCGGGAAGCCCGAGAAAGCGACTTGCGCATCCAT ACCAGGTCCTGGGTTCTCTTCTACGTCTCCACA

The CRISPR guide RNA, Cas9 mRNA, and donor DNA were microinjected into the cytoplasm of FVB zygotes. The goal was to generate transgenic mice that express both Foxe3 and a reporter transgene (nuclear-localized mCherry) driven by the endogenous Foxe3 promoter. Progeny were screened by PCR using primers 334 (CAATGAGCGCGATGTATGAGTAGG) and 437 (catcacctcccacaacgaggacta) to look for targeted integration of the donor DNA, and using the Sense and Antisense primers described above to look for insertion of the full-length donor. One founder male was mated to FVB females, and the F1 progeny were screened by PCR amplifications of tail DNA using primers 334+437. The PCR bands were sequenced. Sibling F1 mice with identical insertions were mated to generate F2 mice. None of the F2 mice had cataracts or microphthalmia. The F2 mice were screened for homozygosity by PCR-based genotyping (334+437 positive; 343 [gagtgtgctgaatgggtgtgtttg] +334 positive for a single band at 1.8 kb, indicative of a 1.2 kb insertion). The PCR bands were sequenced. Homozygous brother/sister matings were used to maintain the line. Homozygous males were used for sperm cryopreservation.

Note: The FVB strain used during the development was transferred from the NIH to the donor's institution >34 years prior, thus establishing the substrain FVB/NOve.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

For more information about this colony's health status contact mmrrc@missouri.edu
Coat Color
White
Eye
Pink
MMRRC Breeding System
Sib-mating
Generation
F20
Overall Breeding Performance
Excellent
Viability and Fertility: Female Male Comments
Homozygotes are viable: Yes Yes
Homozygotes are fertile: Yes Yes
Heterozygotes are fertile: Yes Yes
Age Reproductive Decline: Undetermined Undetermined
Bred to Homozygosity
Yes
Average litter size
5 to 9
Recommended wean age
3 weeks
Average Pups Weaned
5 to 9

Order Information

When this strain becomes available, Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

- Products for this strain are Not Yet Available for Ordering
- If you register interest in this strain, you will be notified when it becomes available for ordering.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.