• Genotyping Protocol(s)
• Center protocol and contact for technical support will be shipped with mice.

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

• Lens induction

Embryo injections were done using two guide RNAs. The target sequence for one guide RNA was GCGACTTGCGCATCCATGTG (cgg), which includes the start codon for Foxe3. The target sequence for the other guide RNA was GGAAGCCTACCTGAGACAGC (cgg), which lies near the 3’-end of the coding sequences for the single exon Foxe3 gene. The following primers were used to amplify a 1.1 kb H2B-mCherry donor (template plasmid from the laboratory of Richard Behringer) for insertion, in-frame, at the ATG codon:

Sense primer: 5’-CCGCATCCCTAGGACCCCCACCCCCACCCCCCGCAC ATGCCAGA GCCAGCGAAG TCTGCTCCCG

Antisense primer: 5’-CACAGGTAGCGCTCCAGCCCCGGCGCGAAGCCCGGCT TCACTTGTACAGCTCGTCCATGCCGCCGGTGGA

The CRISPR guide RNA, Cas9 mRNA, and donor DNA were microinjected into the cytoplasm of FVB zygotes. The goal was to replace the coding sequences of Foxe3 with the reporter transgene (nuclear-localized mCherry). Expression of the reporter will be driven by the endogenous Foxe3 promoter. Progeny were screened by PCR using primers 343 (gagtgtgctgaatgggtgtgtttg) and 436 (atgtgcaccttgaagcgcatgaac) to look for targeted integration of the donor DNA, and using the Sense and Antisense primers described above to look for insertion of the full-length donor. One founder female was mated to an FVB male, and the F1 progeny were screened by PCR amplifications of tail DNA using primers 343+436. The PCR bands were sequenced. Sibling F1 mice with identical insertions were mated to generate F2 mice. Some of the F2 mice had cataracts and microphthalmia. These mice were shown to be homozygous by PCR-based genotyping (343+436 positive; 343+334 (CAATGAGCGCGATGTATGAGTAGG) negative for the WT band at 500 bp). Homozygous brother/sister matings were used to maintain the line. Homozygous males were used for sperm cryopreservation.

Note: The FVB strain used during the development was transferred from the NIH to the donor's institution >34 years prior, thus establishing the substrain FVB/NOve.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.