Strain Name:
C57BL/6J-MtgxR8453Btlr/Mmmh
Stock Number:
067904-MU
Citation ID:
RRID:MMRRC_067904-MU
Other Names:
R8453 (G1)
Major Collection:

Strain Information

Prph
Name: peripherin
Synonyms: Prph1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 19132
VEGA: 15
HGNC: HGNC:9461
Homologene: 4559
Sptbn4
Name: spectrin beta, non-erythrocytic 4
Synonyms: neuroaxonal dystrophy, ROSA62, SpbIV, nmf261, 1700022P15Rik, Spnb4, dyn, 5830426A08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 80297
Homologene: 11879
Thbs4
Name: thrombospondin 4
Synonyms: TSP-4, TSP4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 21828
Homologene: 20691
Mmp10
Name: matrix metallopeptidase 10
Synonyms: stromelysin 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17384
VEGA: 9
HGNC: HGNC:7156
Homologene: 20546
Ark2n
Name: arkadia (RNF111) N-terminal like PKA signaling regulator 2N
Synonyms: Ark2N, 8030462N17Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 212163
VEGA: 18
Homologene: 17035
P4htm
Name: prolyl 4-hydroxylase, transmembrane (endoplasmic reticulum)
Synonyms: 4933406E20Rik, P4h-tm
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74443
Homologene: 41765
Rps6ka2
Name: ribosomal protein S6 kinase, polypeptide 2
Synonyms: Rsk3, 90kDa, Rps6ka-rs1, p90rsk, pp90rsk, D17Wsu134e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20112
VEGA: 17
Homologene: 100680
Yeats2
Name: YEATS domain containing 2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 208146
VEGA: 16
Homologene: 9967
Suco
Name: SUN domain containing ossification factor
Synonyms: AI848100, Opt, osteopotentia
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226551
HGNC: HGNC:1240
Homologene: 32212
Ctc1
Name: CTS telomere maintenance complex component 1
Synonyms: 1500010J02Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68964
Homologene: 11830
Senp7
Name: SUMO1/sentrin specific peptidase 7
Synonyms: 2410152H17Rik, 2900036C23Rik, 2810413I22Rik, 6030449K19Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 66315
Homologene: 10778
Rcl1
Name: RNA terminal phosphate cyclase-like 1
Synonyms: Rnac, 2310040A02Rik, RPCL1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 59028
VEGA: 19
Homologene: 4217
Opa1
Name: OPA1, mitochondrial dynamin like GTPase
Synonyms: 1200011N24Rik, lilr3, optic atrophy 1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74143
HGNC: HGNC:8140
Homologene: 14618
Itprid2
Name: ITPR interacting domain containing 2
Synonyms: SPAG13, CS-1, CS1, KRAP, Ssfa2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 70599
Homologene: 4912
Commd1
Name: COMM domain containing 1
Synonyms: Murr1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17846
Homologene: 17604
Scfd1
Name: Sec1 family domain containing 1
Synonyms: 3110021P21Rik, STXBP1L2, RA410
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 76983
VEGA: 12
Homologene: 5650
Sars1
Name: seryl-tRNA synthetase 1
Synonyms: Strs, Sars
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20226
Homologene: 4751
Iqsec3
Name: IQ motif and Sec7 domain 3
Synonyms: BRAG3, synarfGEF
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243621
Homologene: 46091
Mcf2l
Name: mcf.2 transforming sequence-like
Synonyms: Dbs, C130040G20Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17207
Homologene: 11804
Creb3l1
Name: cAMP responsive element binding protein 3-like 1
Synonyms: BBF-2 (drosophila) homolog, Oasis
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 26427
Homologene: 8058
C3
Name: complement component 3
Synonyms: complement factor 3, acylation stimulating protein, Plp
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12266
HGNC: HGNC:1318
Homologene: 68031
Lpl
Name: lipoprotein lipase
Synonyms: O 1-4-5
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16956
HGNC: HGNC:6677
Homologene: 200
Ccdc187
Name: coiled-coil domain containing 187
Synonyms: 4932418E24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 329366
Homologene: 77630
Il31ra
Name: interleukin 31 receptor A
Synonyms: GLM-R, GPL
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218624
VEGA: 13
Homologene: 51395
Alas1
Name: aminolevulinic acid synthase 1
Synonyms: 5-aminolevulinate synthase, succinyl-CoA: glycine C-succinyl transferase, Alas-1, ALAS-N
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 11655
HGNC: HGNC:396
Homologene: 55478
Gad1
Name: glutamate decarboxylase 1
Synonyms: GAD67, Gad-1, Z49976, EP10, GAD44, GAD25
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14415
HGNC: HGNC:4092
Homologene: 635
Hbs1l
Name: Hbs1-like (S. cerevisiae)
Synonyms: eRFS, 2810035F15Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 56422
VEGA: 10
HGNC: HGNC:4834
Homologene: 68525
Stk40
Name: serine/threonine kinase 40
Synonyms: 2310004N11Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74178
Homologene: 12542
Gemin5
Name: gem nuclear organelle associated protein 5
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216766
Homologene: 9155
Trpc7
Name: transient receptor potential cation channel, subfamily C, member 7
Synonyms: TRP7, Trrp8
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 26946
Homologene: 22689
Tex15
Name: testis expressed gene 15 meiosis and synapsis associated
Synonyms: 2210014E14Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 104271
Homologene: 12837
Bud13
Name: BUD13 homolog
Synonyms: D030060M11Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 215051
Homologene: 13102
Fbxo30
Name: F-box protein 30
Synonyms: 1700026A16Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71865
Homologene: 12959
Stxbp5
Name: syntaxin binding protein 5 (tomosyn)
Synonyms: 4930565N16Rik, LGL3, tomosyn 1, 0710001E20Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 78808
Homologene: 16402
Mink1
Name: misshapen-like kinase 1 (zebrafish)
Synonyms: Misshapen/NIKs-related kinase, MINK, Ysk2, Map4k6
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 50932
Homologene: 56762
Nlrp4b
Name: NLR family, pyrin domain containing 4B
Synonyms: Nalp-gamma, Nalp4b
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 210045
Homologene: 65242
Pold2
Name: polymerase (DNA directed), delta 2, regulatory subunit
Synonyms: p50, po1D2, 50kDa
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18972
HGNC: HGNC:9176
Homologene: 4538
Dnai4
Name: dynein axonemal intermediate chain 4
Synonyms: Wdr78
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242584
Homologene: 11702
Gria1
Name: glutamate receptor, ionotropic, AMPA1 (alpha 1)
Synonyms: GluR1, GluR-A, Glr-1, Glur-1, Glur1, GluRA, Glr1, 2900051M01Rik, HIPA1, GluA1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14799
HGNC: HGNC:4571
Homologene: 20226
Vmn2r18
Name: vomeronasal 2, receptor 18
Synonyms: EG632671
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 632671
Albfm1
Name: albumin superfamily member 1
Synonyms: ARG, Gm17754, 5830473C10Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 622307
Homologene: 129803
Phykpl
Name: 5-phosphohydroxy-L-lysine phospholyase
Synonyms: 2900006B13Rik, Agxt2l2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72947
Homologene: 75268
Nrap
Name: nebulin-related anchoring protein
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18175
HGNC: HGNC:7988
Homologene: 4499
Tnfaip6
Name: tumor necrosis factor alpha induced protein 6
Synonyms: Tsg6, TSG-6, Tnfip6
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 21930
Homologene: 5162
Dlg5
Name: discs large MAGUK scaffold protein 5
Synonyms: 4933429D20Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 71228
HGNC: HGNC:2904
Homologene: 3486
Sh2b1
Name: SH2B adaptor protein 1
Synonyms: SH2-B, SH2-Bb, Irip, Sh2bpsm1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20399
Homologene: 32122
Bmp3
Name: bone morphogenetic protein 3
Synonyms: 9530029I04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 110075
HGNC: HGNC:1070
Homologene: 927
Phldb2
Name: pleckstrin homology like domain, family B, member 2
Synonyms: LL5beta, LL5b, C820004H04Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 208177
Homologene: 17100
Mmrn1
Name: multimerin 1
Synonyms: 4921530G03Rik, Emilin4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 70945
HGNC: HGNC:7178
Homologene: 49134
Chrm3
Name: cholinergic receptor, muscarinic 3, cardiac
Synonyms: M3R, Chrm-3, muscarinic acetylcholine receptor 3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 12671
HGNC: HGNC:1952
Homologene: 20191
Vmn1r61
Name: vomeronasal 1 receptor 61
Synonyms: Gm7186
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 636731
Homologene: 41799
Dixdc1
Name: DIX domain containing 1
Synonyms: 4930563F16Rik, Ccd1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 330938
Homologene: 82369
Mrc2
Name: mannose receptor, C type 2
Synonyms: novel lectin, Endo180, uPARAP
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17534
Homologene: 4408
Cfap43
Name: cilia and flagella associated protein 43
Synonyms: 4930428C11Rik, 4632415N18Rik, 4930463G05Rik, D19Ertd652e, Wdr96
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 100048534
Homologene: 36425
Adam29
Name: a disintegrin and metallopeptidase domain 29
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244486
HGNC: HGNC:207
Homologene: 8607
Wdr27
Name: WD repeat domain 27
Synonyms: 0610012K18Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 71682
VEGA: 17
Homologene: 18417
Pnpla1
Name: patatin-like phospholipase domain containing 1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 433091
Homologene: 25324
Vnn3
Name: vanin 3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 26464
Homologene: 48295
Trabd
Name: TraB domain containing
Synonyms: 5730502D15Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 67976
Homologene: 36427
9630041A04Rik
Name: RIKEN cDNA 9630041A04 gene
Type: Gene
Species: Mouse
Chromosome: 9
Carmil2
Name: capping protein regulator and myosin 1 linker 2
Synonyms: D130029J02Rik, Rltpr
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234695
Homologene: 128439
Senp5
Name: SUMO/sentrin specific peptidase 5
Synonyms: 6230429P13Rik, A730063F07Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 320213
Homologene: 17647
Trim30d
Name: tripartite motif-containing 30D
Synonyms: TRIM30-3, Trim79
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 209387
Homologene: 114426
Igsf5
Name: immunoglobulin superfamily, member 5
Synonyms: 2010003D20Rik, Igsf5, Jam4
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 72058
HGNC: HGNC:5952
Homologene: 12437
Tmem115
Name: transmembrane protein 115
Synonyms: Pl6
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56395
Homologene: 135207
Fam89b
Name: family with sequence similarity 89, member B
Synonyms: 1110021A21Rik, Fam89b, Mtvr2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 17826
Homologene: 18749
Eif1ad14
Name: eukaryotic translation initiation factor 1A domain containing 14
Synonyms: Gm2035
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 100039076
VEGA: 12
Nicn1
Name: nicolin 1
Synonyms: 1500032A17Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 66257
Homologene: 11936
Gm9195
Name: predicted gene 9195
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 675947
Homologene: 139067
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 161,823,017 bp
  • T to A, chromosome 2 at 26,276,446 bp
  • A to C, chromosome 2 at 52,055,867 bp
  • A to T, chromosome 2 at 70,600,713 bp
  • T to C, chromosome 2 at 79,644,785 bp
  • A to T, chromosome 2 at 91,990,929 bp
  • G to A, chromosome 3 at 108,428,713 bp
  • A to G, chromosome 4 at 103,059,916 bp
  • A to G, chromosome 4 at 126,128,973 bp
  • A to T, chromosome 5 at 90,566,501 bp
  • G to A, chromosome 5 at 98,855,423 bp
  • T to A, chromosome 5 at 151,561,908 bp
  • T to A, chromosome 6 at 60,988,377 bp
  • T to C, chromosome 6 at 121,387,820 bp
  • A to G, chromosome 7 at 5,610,887 bp
  • A to G, chromosome 7 at 10,715,601 bp
  • A to G, chromosome 7 at 27,404,238 bp
  • T to A, chromosome 7 at 104,487,740 bp
  • TGGGGACCAGCTCAGCCACGGGGACCAGCTC to TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC, chromosome 7 at 126,467,570 bp
  • T to C, chromosome 8 at 12,984,956 bp
  • G to T, chromosome 8 at 33,576,871 bp
  • T to C, chromosome 8 at 55,873,161 bp
  • A to G, chromosome 8 at 68,895,781 bp
  • A to C, chromosome 8 at 105,690,211 bp
  • T to G, chromosome 9 at 7,508,202 bp
  • A to G, chromosome 9 at 46,288,201 bp
  • T to C, chromosome 9 at 50,684,886 bp
  • G to T, chromosome 9 at 101,938,685 bp
  • C to T, chromosome 9 at 106,236,522 bp
  • T to C, chromosome 9 at 107,534,798 bp
  • T to A, chromosome 9 at 108,293,373 bp
  • C to T, chromosome 9 at 108,580,367 bp
  • A to T, chromosome 10 at 9,809,048 bp
  • A to G, chromosome 10 at 11,290,735 bp
  • A to T, chromosome 10 at 21,309,279 bp
  • G to A, chromosome 10 at 23,869,545 bp
  • A to G, chromosome 11 at 5,875,104 bp
  • C to T, chromosome 11 at 22,978,503 bp
  • T to C, chromosome 11 at 51,598,294 bp
  • T to A, chromosome 11 at 57,243,051 bp
  • T to C, chromosome 11 at 58,125,239 bp
  • T to A, chromosome 11 at 69,022,449 bp
  • T to A, chromosome 11 at 70,610,328 bp
  • T to A, chromosome 11 at 105,332,311 bp
  • A to C, chromosome 12 at 51,412,591 bp
  • C to T, chromosome 12 at 87,919,553 bp
  • A to T, chromosome 13 at 9,877,231 bp
  • A to G, chromosome 13 at 56,822,559 bp
  • G to A, chromosome 13 at 92,790,817 bp
  • A to T, chromosome 13 at 112,524,183 bp
  • T to C, chromosome 14 at 24,158,145 bp
  • T to G, chromosome 14 at 72,440,761 bp
  • G to T, chromosome 15 at 89,085,413 bp
  • G to A, chromosome 15 at 99,056,776 bp
  • C to T, chromosome 16 at 20,222,887 bp
  • G to A, chromosome 16 at 29,620,868 bp
  • A to G, chromosome 16 at 31,989,348 bp
  • A to G, chromosome 16 at 45,825,022 bp
  • A to G, chromosome 16 at 56,188,328 bp
  • A to G, chromosome 16 at 96,421,796 bp
  • A to G, chromosome 17 at 7,246,752 bp
  • T to C, chromosome 17 at 14,892,489 bp
  • T to A, chromosome 17 at 28,858,899 bp
  • T to C, chromosome 17 at 57,212,643 bp
  • T to C, chromosome 18 at 77,673,908 bp
  • A to G, chromosome 19 at 5,728,875 bp
  • T to C, chromosome 19 at 29,115,759 bp
  • A to T, chromosome 19 at 47,746,647 bp
  • T to C, chromosome 19 at 56,323,920 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8453 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067904-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.