MMRRC:068251-JAX

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTTTGTTTCCTCTCAACGT and TTACATTATGGACTGCTATA, which resulted in a 490 bp deletion beginning at Chromosome 2 position 103,873,026 bp and ending after 103,873,515 bp (GRCm39/mm39). This mutation deletes ENSMUSE00001252280 (exon 4) and 375 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 119 and early truncation 17 amino acids later.

Suggested Control Mice

C57BL/6NJ or wild-type from colony

Strain Origin

Donor

Stephen Murray, Ph.D., The Jackson Laboratory.

Colony and Husbandry Information Expand All

Health Status Report

For more information about this colony's health status contact csmmrrc@jax.org

Appearance

Coat Color

Black

Breeding

Generation

N2F2

Overall Breeding Performance

Undetermined

Reproductive Statistics

Viability and Fertility:	Female	Male	Comments
Homozygotes are viable:	Undetermined	Undetermined	Undetermined
Homozygotes are fertile:	Undetermined	Undetermined	Undetermined
Heterozygotes are fertile:	Undetermined	Undetermined	Undetermined
Age Reproductive Decline:	Undetermined	Undetermined

Average litter size

Undetermined

Average Pups Weaned

Undetermined

Order Request Information Expand All

Availability Level

When this strain becomes available, Limited quantities of breeder mice (up to 2 males and 2 females or 4 mice) per investigator per month are available from a live colony, usually available to ship in under 12 weeks. Larger quantities may be available, please contact the distributing center directly at csmmrrc@jax.org for more details.

Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

Conditions of Distribution [Including applicable technology transfer agreements]

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Fees

- Products for this strain are Not Yet Available for Ordering
- If you register interest in this strain, you will be notified when it becomes available for ordering.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.

Strain Detail Sheet

Gene Information Expand All

Colony and Husbandry Information Expand All

Order Request Information Expand All