Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8964Btlr/Mmmh
Stock Number:
068798-MU
Citation ID:
RRID:MMRRC_068798-MU
Other Names:
R8964 (G1)
Major Collection:

Strain Information

Met
Name: met proto-oncogene, receptor tyrosine kinase
Synonyms: HGF receptor, c-Met, Par4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 17295
HGNC: HGNC:7029
Homologene: 206
Pzp2
Name: PZP alpha-2-macroglobulin like 2
Synonyms: Pzp
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 11287
Homologene: 104112
Sntb2
Name: syntrophin, basic 2
Synonyms: Snt2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 20650
Homologene: 4911
Wdr82
Name: WD repeat domain containing 82
Synonyms: 9430077D24Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 77305
Homologene: 42951
Adck2
Name: aarF domain containing kinase 2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 57869
Homologene: 49103
Cdc42ep4
Name: CDC42 effector protein 4
Synonyms: CEP4, Borg4, 1500041M20Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 56699
Homologene: 8110
B3galnt1
Name: UDP-GalNAc:betaGlcNAc beta 1,3-galactosaminyltransferase, polypeptide 1
Synonyms: Mbrn 1, Brainiac 1, Globoside blood group, B3galt3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 26879
HGNC: HGNC:918
Homologene: 32457
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 93,145,147 bp
  • C to T, chromosome 1 at 150,105,047 bp
  • A to T, chromosome 2 at 26,481,050 bp
  • A to G, chromosome 2 at 53,145,894 bp
  • A to G, chromosome 2 at 69,286,717 bp
  • T to G, chromosome 2 at 76,720,965 bp
  • T to A, chromosome 2 at 85,776,620 bp
  • T to C, chromosome 2 at 102,634,466 bp
  • T to A, chromosome 2 at 154,230,278 bp
  • A to G, chromosome 3 at 10,348,571 bp
  • A to G, chromosome 3 at 69,575,256 bp
  • T to C, chromosome 3 at 73,701,073 bp
  • T to A, chromosome 3 at 86,351,245 bp
  • T to C, chromosome 3 at 86,836,391 bp
  • T to C, chromosome 3 at 89,142,729 bp
  • G to A, chromosome 4 at 43,450,218 bp
  • A to T, chromosome 4 at 99,061,239 bp
  • T to A, chromosome 5 at 34,905,376 bp
  • C to T, chromosome 5 at 36,229,167 bp
  • T to A, chromosome 5 at 52,368,354 bp
  • T to A, chromosome 5 at 108,848,165 bp
  • C to T, chromosome 6 at 17,527,145 bp
  • G to T, chromosome 6 at 39,574,149 bp
  • T to C, chromosome 6 at 87,844,104 bp
  • A to T, chromosome 6 at 124,398,781 bp
  • T to A, chromosome 6 at 128,487,499 bp
  • A to G, chromosome 7 at 24,923,037 bp
  • A to T, chromosome 7 at 41,647,579 bp
  • A to G, chromosome 7 at 102,016,384 bp
  • G to A, chromosome 7 at 118,561,005 bp
  • C to T, chromosome 7 at 131,138,987 bp
  • A to G, chromosome 7 at 143,869,293 bp
  • T to C, chromosome 8 at 22,653,325 bp
  • A to G, chromosome 8 at 68,811,979 bp
  • T to G, chromosome 8 at 77,155,312 bp
  • T to C, chromosome 8 at 84,959,805 bp
  • T to A, chromosome 8 at 94,505,488 bp
  • T to A, chromosome 8 at 106,981,176 bp
  • T to C, chromosome 8 at 107,045,054 bp
  • C to T, chromosome 8 at 119,566,160 bp
  • T to A, chromosome 9 at 65,407,631 bp
  • T to A, chromosome 9 at 66,445,590 bp
  • T to C, chromosome 9 at 106,176,662 bp
  • G to A, chromosome 9 at 123,183,496 bp
  • T to C, chromosome 10 at 5,110,872 bp
  • T to C, chromosome 10 at 6,919,789 bp
  • A to T, chromosome 10 at 67,909,258 bp
  • A to T, chromosome 10 at 78,447,937 bp
  • C to T, chromosome 10 at 84,374,870 bp
  • T to A, chromosome 10 at 118,166,680 bp
  • A to T, chromosome 11 at 4,910,647 bp
  • G to A, chromosome 11 at 22,151,154 bp
  • T to C, chromosome 11 at 94,991,879 bp
  • A to G, chromosome 11 at 97,146,343 bp
  • A to T, chromosome 11 at 110,147,249 bp
  • G to A, chromosome 11 at 110,248,537 bp
  • T to A, chromosome 11 at 113,729,452 bp
  • G to A, chromosome 12 at 81,993,038 bp
  • T to A, chromosome 12 at 87,271,357 bp
  • A to G, chromosome 12 at 101,845,056 bp
  • A to G, chromosome 13 at 27,099,943 bp
  • A to C, chromosome 13 at 51,419,212 bp
  • G to T, chromosome 14 at 8,243,768 bp
  • C to A, chromosome 14 at 55,897,713 bp
  • A to T, chromosome 15 at 56,667,665 bp
  • C to T, chromosome 15 at 91,235,769 bp
  • AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC to AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC, chromosome 15 at 101,850,378 bp
  • T to C, chromosome 15 at 102,103,118 bp
  • A to G, chromosome 16 at 3,911,470 bp
  • A to G, chromosome 16 at 4,091,889 bp
  • G to A, chromosome 16 at 10,421,030 bp
  • T to G, chromosome 17 at 26,142,744 bp
  • C to A, chromosome 17 at 28,558,756 bp
  • A to G, chromosome 17 at 29,600,228 bp
  • T to C, chromosome 17 at 33,021,736 bp
  • T to C, chromosome 17 at 35,659,807 bp
  • G to A, chromosome 17 at 37,498,773 bp
  • A to T, chromosome 17 at 43,691,667 bp
  • C to A, chromosome 17 at 56,786,696 bp
  • C to A, chromosome 17 at 57,299,122 bp
  • T to A, chromosome 18 at 37,423,607 bp
  • A to T, chromosome 19 at 60,763,192 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8964 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068798-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.