Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9152Btlr/Mmmh
Stock Number:
068939-MU
Citation ID:
RRID:MMRRC_068939-MU
Other Names:
R9152 (G1)
Major Collection:

Strain Information

Elf1
Name: E74 like ETS transcription factor 1
Synonyms: Elf-1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13709
VEGA: 14
HGNC: HGNC:3316
Homologene: 7303
Macroh2a1
Name: macroH2A.1 histone
Synonyms: mH2a1, MACROH2A1.2, H2AF12M, H2afy
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 26914
HGNC: HGNC:4740
Homologene: 3598
Trp53bp1
Name: transformation related protein 53 binding protein 1
Synonyms: 53BP1, p53BP1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27223
Homologene: 4137
Pik3c2a
Name: phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha
Synonyms: PI3KC2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18704
HGNC: HGNC:8971
Homologene: 20581
Ap3b1
Name: adaptor-related protein complex 3, beta 1 subunit
Synonyms: rim2, recombination induced mutation 2, Hps2, beta3A, AP-3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 11774
VEGA: 13
HGNC: HGNC:566
Homologene: 68125
Akap13
Name: A kinase anchor protein 13
Synonyms: AKAP-Lbc, PROTO-LBC, PROTO-LB, Ht31, 5730522G15Rik, 1700026G02Rik, 5830460E08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75547
HGNC: HGNC:371
Homologene: 4903
Septin11
Name: septin 11
Synonyms: 6230410I01Rik, D5Ertd606e, Sept11
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 52398
Homologene: 56800
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 21,469,468 bp
  • GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC to GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC, chromosome 1 at 172,128,583 bp
  • T to A, chromosome 2 at 36,421,427 bp
  • T to C, chromosome 2 at 120,698,587 bp
  • T to C, chromosome 2 at 121,198,575 bp
  • A to T, chromosome 3 at 129,813,254 bp
  • T to C, chromosome 4 at 58,785,114 bp
  • G to A, chromosome 4 at 137,522,565 bp
  • T to C, chromosome 5 at 45,463,912 bp
  • T to C, chromosome 5 at 93,139,470 bp
  • G to T, chromosome 5 at 100,770,459 bp
  • T to A, chromosome 5 at 106,841,745 bp
  • A to G, chromosome 5 at 113,819,406 bp
  • T to C, chromosome 5 at 137,114,533 bp
  • A to T, chromosome 7 at 18,726,721 bp
  • A to G, chromosome 7 at 19,149,100 bp
  • T to A, chromosome 7 at 75,611,285 bp
  • G to A, chromosome 7 at 116,417,769 bp
  • A to G, chromosome 7 at 123,001,474 bp
  • A to T, chromosome 7 at 140,297,343 bp
  • T to C, chromosome 8 at 13,105,799 bp
  • C to T, chromosome 8 at 19,026,542 bp
  • A to C, chromosome 8 at 27,345,351 bp
  • A to T, chromosome 8 at 105,772,508 bp
  • A to G, chromosome 8 at 111,319,771 bp
  • A to T, chromosome 9 at 19,497,152 bp
  • A to G, chromosome 9 at 56,888,179 bp
  • A to G, chromosome 11 at 61,158,375 bp
  • T to C, chromosome 11 at 66,130,631 bp
  • G to A, chromosome 12 at 69,185,723 bp
  • T to C, chromosome 12 at 73,691,644 bp
  • T to C, chromosome 12 at 81,975,815 bp
  • G to A, chromosome 12 at 84,791,090 bp
  • G to A, chromosome 12 at 86,988,418 bp
  • T to C, chromosome 12 at 88,027,176 bp
  • CTTACCTCCAGCT to C, chromosome 13 at 56,084,191 bp
  • T to C, chromosome 13 at 94,472,931 bp
  • T to A, chromosome 13 at 94,493,731 bp
  • C to A, chromosome 13 at 104,476,767 bp
  • C to T, chromosome 14 at 37,072,230 bp
  • A to C, chromosome 14 at 50,866,705 bp
  • A to G, chromosome 14 at 53,831,554 bp
  • T to C, chromosome 14 at 79,570,912 bp
  • G to A, chromosome 15 at 89,475,792 bp
  • T to A, chromosome 18 at 20,283,272 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9152 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068939-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.