Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-Kmt2aem4Lutzy/Mmjax
Stock Number:
069631-JAX
Citation ID:
RRID:MMRRC_069631-JAX
Other Names:
Kmt2aC1186Y

Strain Information

Kmt2aem4Lutzy
Name: lysine (K)-specific methyltransferase 2A; endonuclease-mediated mutation 4, Cathy Lutz
Synonyms: Kmt2aC1186Y
Type: Allele
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: CRISPR
Kmt2a
Name: lysine (K)-specific methyltransferase 2A
Synonyms: trithorax Drosophila, HTRX1, ALL-1, All1, Cxxc7, Mll, Mll1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 214162
HGNC: HGNC:7132
Homologene: 4338
Genetic Alterations

Kmt2aC1186Y is a CRISPR/Cas9 generated mutant of the lysine (K)-specific methyltransferase 2A gene carrying the C1186Y (cysteine to tyrosine) mutation in exon 5. These mice may be useful in studying Wiedemann-Steiner Syndrome.

HVGS Nomenclature
  • Genbank RefSeq - mRNA: NM_001357549.2
  • Genbank RefSeq, protein: NP_001344478.1
  • Variant, nucleic acid level: c.3557G>A
  • Variant, amino acid level, predicted: p.Cys1186Tyr (C1186Y)
  • Check this variant: LUMC Mutalyzer
ES Cell Line
Not applicable
Phenotype

The Kmt2a (lysine (K)-specific methyltransferase 2A, also known asMLL)) encodes a histone modification enzyme involved in the regulation of geneexpression in early development and hematopoiesis. Mutations in Kmt2aare associated with Wiedemann-Steiner Syndrome a condition characterized bydevelopmental delay, short stature, some facial dysmorphia and low muscle tone.

To create the Kmt2aC1186Y allele, CRISPR/Cas9endonuclease-mediated genome editing of Kmt2a exon 5 was used tointroduce the C1186Y (cysteine to tyrosine) mutation. C1186Y is orthologous tothe clinical mutation C1189Y associated with Wiedemann-Steiner Syndrome. Heterozygousmice are viable and fertile. In the homozygous state, the mutation is embryonicor perinatal lethal.

Strain GQC Summary
Coisogenic strain carrying the em4Lutzy allele of the Kmt2a gene on C57BL/6J background. C57BL/6J was detected with diagnostic alleles. The genome of this strain is fully replicable. This GQC report is based on the MiniMUGA G3 2024 pipeline using 1 sample genotyped in 2026.
MMRRC Strain GQC Report
Suggested Control Mice
Littermates of all relevant genotypes.
  • Developmental Biology
Submitter
Cat Lutz, Ph.D., The Jackson Laboratory.
Primary Reference
Not ready to publish
Strain Development
The Kmt2aem4Lutzy (Kmt2aC1186Y) allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing at The Jackson Laboratory. Guide RNAs (TATAAAGAAGCAATGCTGCAA, AAGAAGCAATGCTGCAAGTGA, and GAAGCAATGCTGCAAGTGAG) were selected to target exon 5 of the lysine (K)-specific methyltransferase 2A locus on Chromosome 9. Donor DNAs were created encoding a C1186Y mutation (TGC to TAC, cysteine to tyrosine). These sequences and Cas9 nuclease were introduced into C57BL/6J zygotes, and then transferred to pseudopregnant females. Progeny were screened by DNA sequencing of the targeted region, which identified and identified as harboring the desired allele. Founder 3269 was bred to C57BL/6J (Stock No. 000664) for germline transmission. The colony was backcrossed to C57BL/6J for a total of at least two generations.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Cryo-recovered strains distributed by the MMRRC at JAX are shipped to the customer from the Pathogen & Opportunistic-Free Animal Room G200 - see https://www.jax.org/jax-mice-and-services/customer-support/customer-service/animal-health/health-status-reports.

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email csmmrrc@jax.org.
Coat Color
Black
Eye
Black
MMRRC Breeding System
Backross and sib-mating
Generation
N2 (C57BL/6J), F?
Overall Breeding Performance
Undetermined
Viability and Fertility: Female Male Comments
Homozygotes are viable: No No
Homozygotes are fertile: No No
Heterozygotes are fertile: Yes Yes
Age Reproductive Decline: Undetermined Undetermined
Average litter size
Undetermined
Recommended wean age
4 Weeks
Average Pups Weaned
Undetermined

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069631-JAX-SPERM Cryo-preserved spermatozoa $473.00 / $473.00
Non-Profit / For-Profit
Aliquot Approximate quantity3
069631-JAX-RESUS Litter recovered from cryo-archive $2,187.00 / $2,187.00
Non-Profit / For-Profit
Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.