In House CRISPR/cas9 endonuclease mediated a 7 nucleotide deletion (generating a frameshift) of Kcnq2, potassium voltage-gated channel, subfamily Q, member 2, in C57BL/6J.

CRISPR

Unknown

The Kcnq2^E254fs*16 knock-in (KI) allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing. Guide RNAs (CTGGTGTACTTGGCAGAAAA and TCTGGTGTACTTGGCAGAAA) were used to target the potassium voltage-gated channel, subfamily Q, member 2 (Kcnq2) gene on chromosome 2. Donor DNAs were originally designed to introduce a G256W mutation, as described for MMRRC: 071896. Guide RNAs, cas9, and the oligo donor were introduced to single cell C57BL/6J zygotes and transferred to pseudo pregnant females. DNA sequencing of the targeted region identified a single founder female that carried the desired G256W mutation in trans to a frameshifting indel E254fs*16 mutation (deletion of the AAAGGG nucleotides overlapping with the PAM sequence). The two alleles were separated and two distinct lines [Kcnq2^G256W and Kcnq2^E254fs*16] were established by backcrossing to C57BL/6J for at least 3 generations.

wildtype littermates or C57BL/6J inbred mice

The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact csmmrrc@jax.org. Older strains may not have this information.

Cat Lutz, Ph.D., The Jackson Laboratory.

In preparation, submitted, or in press