This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GATGAGGGACGCACTGGCGT targeting the 5' side and TGGCCCGCAGGAGGTCTATG targeting the 3' side of a critical region (ENSMUSE00000203326) along with a single-strand oligonucleotide encoding a Bxb1 attB site. This resulted in a 357-bp deletion of Chr7 from 44,723,999 to 44,724,355 (GRCm39) with an insertion of a Bxb1 attB sequence (GGCTTGTCGACGACGGCGGTCTCCGTCGTCAGGATCATACACCTT).

Phenotyping data may be available at mousephenotype.org.

The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.

Littermates of all relevant genotypes.

Lauryl Nutter, Ph.D., The Toronto Centre for Phenogenomics.

Cas9 components were microinjected or electroporated into C57BL/6NCrl zygotes and progeny were screened for the desired mutation. Founders were mated to C57BL/6NCrl mice, and derived N1 progeny were identified by PCR and/or sequencing and subjected to quality control including allele sequencing. N1 mice passing QC were then backcrossed to C57BL/6NCrl mice to generate N2 mice identified by PCR. Mutant mice backcrossed at least 2 generations (N2 or more) were intercrossed to produce cohorts for phenotyping. Backcrossed (N2 or more) or intercrossed (N2F1 or more) heterozygous mice were used for cryopreservation.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.