This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of AGCACCAAACAGCGGUACCU targeting the 5' side and GAAUCAAUGGCAUCGACCAA targeting the 3' side of a critical region (ENSMUSG00000045691.15). This resulted in a 2695-bp deletion chr14:55332584 to 55335278 (GRCm39) which deleted the entire open reading frame.

Phenotyping data may be available at mousephenotype.org.

Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Littermates of all relevant genotypes.

Lauryl Nutter, Ph.D., The Toronto Centre for Phenogenomics.

Cas9 components were microinjected or electroporated into C57BL/6NCrl zygotes and progeny were screened for the desired mutation. Founders were mated to C57BL/6NCrl mice, and derived N1 progeny were identified by PCR and/or sequencing and subjected to quality control including allele sequencing. N1 mice passing QC were then backcrossed to C57BL/6NCrl mice to generate N2 mice identified by PCR. Mutant mice backcrossed at least 2 generations (N2 or more) were intercrossed to produce cohorts for phenotyping. Backcrossed (N2 or more) or intercrossed (N2F1 or more) heterozygous mice were used for cryopreservation.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.