Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-Mecp2em10Lutzy/Mmjax
Stock Number:
076435-JAX
Citation ID:
RRID:MMRRC_076435-JAX
Other Names:
C57BL/6J-Mecp2em10Lutzy/Mmjax

Strain Information

QUALITY CONTROL OF C57BL/6J-Mecp2em10Lutzy/Mmjax  |  The Jackson Laboratory
Last Updated:
Strain Data and Information Information by Submitter Assessed by MMRRC1,2
Published Provided
Allele-specific genotype3 n.d.
Genetic background n.d.
Viability of genotypes available for distribution n.d.
Specific Pathogen- Status n.d.
Recoverability of cryopreserved sperm/embryos4 n.d.
Gene or allele sequence3 n.d.
Gene or allele expression3 n.d.
Gene or allele function3 n.d.
Observable and/or measurable phenotypes n.d.
Fertility of genotypes available for distribution n.d.
Fecundity/breeding performance n.d.

1 When indicated as "assessed by MMRRC" ("YES"), please note that the information presented on this strain is to the best of our knowledge correct and up-to-date at the the MMRRC Distribution Center assigned to maintain and distribute this strain. This information is subject to change due to breeding, maintenance, and other actions. Please direct any questions on the information presented in this table to the MMRRC Distribution Center.

2 If an assessment has not been performed by the MMRRC (as indicated by "NO"), investigators may request specific testing for a fee. Requests should be submitted directly to the MMRRC Distribution Center assigned to the management, archiving, and distribution of the strain. A full listing of available testing and analytical services is available at https://www.mmrrc.org/about/services.php.

3 This information may or may not apply to each individual engineered allele (e.g., Cre, FlpO) present in the strain.

4 Recovery refers to thawing, in vitro fertilization (IVF), and/or embryo culture leading to live offspring.

Mecp2em10Lutzy
Name: methyl CpG binding protein 2; endonuclease-mediated mutation 10, Cathy Lutz
Type: Allele
Species: Mus musculus (mouse)
Chromosome: X
Alteration at locus: CRISPR
Mecp2
Name: methyl CpG binding protein 2
Synonyms: WBP10, Mbd5, 1500041B07Rik, D630021H01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 17257
HGNC: HGNC:6990
Homologene: 3657
Genetic Alterations
Using CRISPR/Cas9 endonuclease-mediated genome editing, a single guide RNA (AGGTGGTTTCTGCTCTCTCC) was used to insert an R168W mutation (AGA>TGG), as well as a S166S silent mutation (TCC>TCT), into exon 4 of the methyl CpG binding protein 2 (Mecp2).
ES Cell Line
Not applicable
Phenotype
Mecp2 (Methyl-CpG-binding protein 2) codes for a transcription factor that is critical for neuronal differentiation, maintenance and synaptic function. Heterozygous and homozygous females are viable and fertile. Hemizygous males are also viable and fertile. Hemizygous males demonstrated a slight increase in Bird scores and subtle changes in openfield behavior, compared to sex-matched wildtype controls.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
  • Neurobiology
  • Rett Syndrome (RTT)
  • Neurodevelopmental Disorders
  • Motor function, speech, and brain development
Submitter
Cat Lutz, Ph.D., The Jackson Laboratory.
Primary Reference
Publication neither planned nor in preparation
Strain Development
The Mecp2S166S,R168W knock-in allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing. A single guide RNA was used to insert an R168W mutation (AGA>TGG), as well as a S166S silent mutation (TCC>TCT), into exon 4 of the methyl CpG binding protein 2 (Mecp2) on chromosome X. Guide RNA, Cas9 nuclease, and the donor template were introduced to single cell C57BL/6J zygotes and transferred to pseudo pregnant females. Strain Progeny were screened by DNA sequencing to identify correctly targeted pups, which were then bred to C57BL/6J mice for germline transmission. The colony was backcrossed to C57BL/6J for at least two generations.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

These mice may be challenging breeders, demonstrating an increase in loss of first litters as well as a significant decline in breeding performance as the mice age. Progeny generated from heterozygous females bred to hemizygous males were born in close to expected Mendelian ratios (N=21).

Cryo-recovered strains distributed by the MMRRC at JAX are shipped to the customer from the Pathogen & Opportunistic-Free Animal Room G200 - see https://www.jax.org/jax-mice-and-services/customer-support/customer-service/animal-health/health-status-reports.

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email csmmrrc@jax.org.
Coat Color
Black
Eye
Black
MMRRC Breeding System
Sib-mating
Generation
N>2
Overall Breeding Performance
Good
NOTE: "Hemizygote" as used here refers to males carrying a mutation on the X Chromosome or mice of either sex carrying an inserted transgene with no homologous allele on the other chromosome.
Viability and Fertility: Female Male Comments
Homozygotes are viable: Yes X-linked
Homozygotes are fertile: Yes X-linked
Hetero/Hemizygotes are fertile: Yes Yes
Age Reproductive Decline: 4 to 6 months 4 to 6 months
Average litter size
4 to 6
Recommended wean age
3 Weeks
Average Pups Weaned
4 to 6

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
076435-JAX-SPERM Cryo-preserved spermatozoa $473.00 / $473.00
Non-Profit / For-Profit
Aliquot Approximate quantity3
076435-JAX-RESUS Litter recovered from cryo-archive $2,187.00 / $2,187.00
Non-Profit / For-Profit
Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.