Register New MMRRC Account
Reset Password
Register for New Mouse Models
Click Here for Additional Contact Information
Availability & Fees Order this Strain
1 When indicated as verified ("YES"), then please note that information presented is to the best of our knowledge correct and up-to-date at the time of verification at the MMRRC Distribution Center; however, this information is subject to change due to breeding, maintenance, and other actions on the mouse strain at the MMRRC Distribution Center; direct any questions on this table to the MMRRC Distribution Center for this mouse stain.
2 If verification has not been performed (as indicated by "NO"), investigators may request specific verification testing for a fee. Requests should be submitted directly to the MMRRC Distribution Center assigned to the management, archiving, and distribution of the strain. A full listing of available testing and analytical services is available at https://www.mmrrc.org/about/services.php.
3 This information may or may not apply to each individual engineered allele (e.g., Cre, FlpO) present in the strain.
4 Recovery refers to thawing, in vitro fertilization (IVF), and/or embryo culture leading to live offspring.
MD-Gata2 mice have the mitotic degradation (MD) domain sequence of cyclin B1 (Ccnb1) inserted after the start codon in exon 2 of the Gata2 gene, resulting in degradation of GATA2 during the mitosis-to-G1 (M-G1) transition. These mice may be useful when studying hematopoiesis.Note that a control strain has been made available, MDMUT-Gata2 (Stock No. 071769).
To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.
The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.
Silvério-Alves R, Kurochkin I, Rydström A, Vazquez Echegaray C, Haider J, Nicholls M, Rode C, Thelaus L, Lindgren AY, Ferreira AG, Brandão R, Larsson J, de Bruijn MFTR, Martin-Gonzalez J, Pereira CF. GATA2 mitotic bookmarking is required for definitive haematopoiesis. Nat Commun. 2023 Aug 14;14(1):4645. doi: 10.1038/s41467-023-40391-x. (Medline PMID: 37580379)
The MD-Gata2 knock-in (KI) allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing. A guide RNA (GACACAGTAGTGGACCATGGAGG) was used to introduce the mitotic degradation (MD) domain sequence of cyclin B1 (Ccnb1) inserted after the start codon in exon 2 of the GATA binding protein 2 gene (Gata2) on chromosome 6 (ENSMUSG00000015053). The gRNA was cloned in plasmid pX458 (Addgene; Cat#48138) that co-expresses GFP and Cas9 together with the gRNA. The homologous repair template used was a dsDNA construct where the MD sequence is flanked by 800bp homology arms. GFP-positive cells were sorted by FACs 48h later and plated, 6 days later individual ESC colonies were picked, expanded and genotyped. Two independent MD-Gata2-positive (C57BL/6N x 129S) F1 embryonic stem cell clones where then microinjected into 8-cell C57BL/6NRj morulae to generate chimeras. Correctly targeted pups were identified by PCR and sequencing. The resulting MD-Gata2 KI mice were bred to C57BL/6NRj (Janvier Labs) mice for at least 1 generation by the donating laboratory. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6NJ oocytes.
Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.
Limited quantities of breeder mice (up to 2 males and 2 females or 4 mice) per investigator per month are available from a live colony, usually available to ship in under 12 weeks. Larger quantities may be available, please contact the distributing center directly at csmmrrc@jax.org for more details.
Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.
Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.
Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.
1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.
2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.
3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.
4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.
We use cookies to improve your experience, personalize content, and analyze traffic. By using this site, you agree to our use of cookies. For more details, please visit our Privacy Policy.