Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-Epas1em1Fsl/Mmjax
Stock Number:
075770-JAX
Citation ID:
RRID:MMRRC_075770-JAX
Other Names:
Hif2a H194R

Strain Information

Epas1em1Fsl
Name: endothelial PAS domain protein 1; endonuclease-mediated mutation 1, Frank Lee
Type: Allele
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Knock-In
Epas1
Name: endothelial PAS domain protein 1
Synonyms: MOP2, HIF-2alpha, Hif like protein, hypoxia inducible transcription factor 2alpha, HLF, HRF, HIF2A, bHLHe73
Type: Gene
Species: Mouse
Chromosome: 17
Alteration at locus: Knock-In
NCBI: 13819
VEGA: 17
HGNC: HGNC:3374
Homologene: 1095
Genetic Alterations
Hif2aH194R knock-in (KI) mice have a point mutation in exon 6 of the Epas1 gene, resulting in a H194R amino acid substitution. These mice may be useful when studying oxygen homeostasis and high-altitude adaptation.
ES Cell Line
Not applicable
Phenotype
The endothelial PAS domain protein 1 (Epas1) gene encodes a subunit of the hypoxia-inducible factor (HIF) complex, referred to as hypoxia-inducible factor 2-alpha (HIF-2α). HIF is a transcription factor that regulates oxygen homeostasis by regulating pulmonary vascular tone, respiration, erythropoiesis (red blood cell production), and angiogenesis. These Hif2aH194R knock-in (KI) mice have a point mutation (A>G) in exon 6 of the Epas1 gene, resulting in a histidine to arginine substitution at residue 194 (H194R). This hypomorphic mutation impairs the binding of HIF-2α to its heterodimeric partner, aryl hydrocarbon receptor nuclear translocator (ARNT). This particular mutation is found in a high-altitude Andean human population.

Homozygous mice are viable and fertile. Homozygous Hif2aH194R KI mice display protection against hypoxia-induced pulmonary hypertension. These mice may be useful for studying HIF pathway and high-altitude adaptation.

MeSH Terms
  • Animals
  • Humans
  • Mice
  • Adaptation, Physiological/genetics
  • Alleles
  • Altitude
  • Basic Helix-Loop-Helix Transcription Factors/genetics
  • Hypoxia/genetics
  • Nitric Oxide
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
  • Internal/Organ
  • Models for Human Disease
  • Research Tools
Donor
Frank Lee, M.D., Perelman School of Medicine, University of Pennsylvania.
Primary Reference

Jorgensen K, Song D, Weinstein J, Garcia OA, Pearson LN, Inclán M, Rivera-Chira M, León-Velarde F, Kiyamu M, Brutsaert TD, Bigham AW, Lee FS. High-Altitude Andean H194R HIF2A Allele Is a Hypomorphic Allele. Mol Biol Evol. 2023 Jul 5;40(7):msad162. doi: 10.1093/molbev/msad162. (Medline PMID: 37463421)

Strain Development
The Hif2aH194R allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing. Two guide RNAs (TAGGCCCCAGGTCCTGCACTGCAC and AAACGTGCAGTGCAGGACCTGGGG), along with a single stranded oligodeoxynucleotide donor, were used to introduce an A to G point mutation in exon 6 of the endothelial PAS domain protein 1 (Epas1) gene on chromosome 17. This point mutation results in a histidine to arginine substitution at residue 194 (H194R). Cas9 nuclease, gRNAs and single-stranded donor DNA were introduced into the cytoplasm of zygotes derived from C57BL/6J mice with well recognized pronuclei. Correctly targeted pups were identified by PCR and sequencing. The donating investigator notes that sequencing of five potential off-target loci, one with two mismatches to the gRNA sequence and four with three mismatches, did not reveal any off-target effects of the gRNA. Founder mice were backcrossed to C57BL/6J mice for at least 2 generations by the donating laboratory. To establish a live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

For more information about this colony's health status contact csmmrrc@jax.org
Coat Color
Black
Eye
Black
MMRRC Breeding System
Sib-mating
Generation
N/A
Overall Breeding Performance
Excellent
Viability and Fertility: Female Male Comments
Homozygotes are viable: Yes Yes
Homozygotes are fertile: Yes Yes
Heterozygotes are fertile: Yes Yes
Age Reproductive Decline: 10 to 12 months Greater than 12 months
Average litter size
4 to 6
Recommended wean age
3 Weeks
Average Pups Weaned
4 to 6

Order Information

Limited quantities of breeder mice (up to 2 males and 2 females or 4 mice) per investigator per month are available from a live colony, usually available to ship in under 12 weeks. Larger quantities may be available, please contact the distributing center directly at csmmrrc@jax.org for more details.

Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
075770-JAX-HOM-F
075770-JAX-HOM-M
075770-JAX-HET-F
075770-JAX-HET-M
075770-JAX-WT-F
075770-JAX-WT-M
Homozygous Female
Homozygous Male
Heterozygous / Hemizygous Female
Heterozygous / Hemizygous Male
Wild Type Female
Wild Type Male
$229.00 / Non-Profit Per Mouse The csmmrrc@jax.org may assess additional fees for any special requests (e.g., specific age or weight of mice, etc.).
Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.