Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR0363Btlr/Mmmh
Stock Number:
038569-MU
Citation ID:
RRID:MMRRC_038569-MU
Other Names:
R0363 (G1), C57BL/6J-MtgxR0363Btlr
Major Collection:

Strain Information

Mtmr3
Name: myotubularin related protein 3
Synonyms: FYVE-DSP1, 1700092A20Rik, ZFYVE10
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74302
HGNC: HGNC:7451
Homologene: 23662
P2rx7
Name: purinergic receptor P2X, ligand-gated ion channel, 7
Synonyms: P2X7 receptor, P2X7R, P2X(7)
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18439
HGNC: HGNC:8537
Homologene: 1925
Etv5
Name: ets variant 5
Synonyms: 8430401F14Rik, erm, 1110005E01Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 104156
HGNC: HGNC:3494
Homologene: 3276
Tmem87b
Name: transmembrane protein 87B
Synonyms: 2810431I02Rik, 2610301K12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72477
Homologene: 69513
Arhgap21
Name: Rho GTPase activating protein 21
Synonyms: 5530401C11Rik, ARHGAP10
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71435
Homologene: 10822
Ankrd12
Name: ankyrin repeat domain 12
Synonyms: ANCO-2, GAC-1, 2900001A12Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106585
Homologene: 9059
Prrc2c
Name: proline-rich coiled-coil 2C
Synonyms: 9630039I18Rik, 1810043M20Rik, Bat2d, Bat2l2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226562
Homologene: 41015
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 4,347,718 bp
  • CTTGTTGTTGTTGTTGTTG to CTTGTTGTTGTTGTTGTTGTTG, chromosome 1 at 40,442,574 bp
  • A to G, chromosome 1 at 44,211,030 bp
  • T to C, chromosome 1 at 46,236,788 bp
  • A to G, chromosome 1 at 100,274,468 bp
  • A to G, chromosome 1 at 162,697,811 bp
  • T to A, chromosome 1 at 191,012,254 bp
  • C to A, chromosome 2 at 20,881,133 bp
  • G to C, chromosome 2 at 32,377,363 bp
  • T to G, chromosome 2 at 85,040,674 bp
  • A to T, chromosome 2 at 90,281,856 bp
  • G to A, chromosome 2 at 119,382,960 bp
  • T to C, chromosome 2 at 121,302,044 bp
  • C to G, chromosome 2 at 121,347,355 bp
  • T to A, chromosome 2 at 128,831,233 bp
  • A to G, chromosome 2 at 129,076,061 bp
  • A to G, chromosome 2 at 161,014,324 bp
  • C to T, chromosome 2 at 164,840,136 bp
  • T to C, chromosome 2 at 178,346,411 bp
  • T to C, chromosome 3 at 146,944,215 bp
  • A to C, chromosome 4 at 21,679,737 bp
  • T to A, chromosome 4 at 109,524,323 bp
  • A to G, chromosome 4 at 127,235,521 bp
  • A to G, chromosome 4 at 139,391,860 bp
  • C to T, chromosome 4 at 143,991,651 bp
  • A to G, chromosome 4 at 154,063,949 bp
  • T to C, chromosome 5 at 109,676,888 bp
  • C to T, chromosome 5 at 122,657,030 bp
  • T to C, chromosome 5 at 145,455,879 bp
  • G to A, chromosome 6 at 4,518,822 bp
  • G to A, chromosome 6 at 87,819,185 bp
  • G to A, chromosome 6 at 140,591,747 bp
  • A to T, chromosome 7 at 5,410,637 bp
  • A to G, chromosome 7 at 79,350,813 bp
  • A to T, chromosome 7 at 108,465,734 bp
  • A to T, chromosome 7 at 131,316,262 bp
  • A to T, chromosome 7 at 141,800,960 bp
  • T to C, chromosome 8 at 71,717,490 bp
  • T to C, chromosome 8 at 72,252,894 bp
  • T to C, chromosome 8 at 72,256,724 bp
  • T to C, chromosome 8 at 81,884,257 bp
  • T to A, chromosome 8 at 111,349,289 bp
  • A to T, chromosome 8 at 112,856,511 bp
  • A to T, chromosome 9 at 43,111,753 bp
  • A to G, chromosome 9 at 44,809,713 bp
  • T to C, chromosome 9 at 122,368,146 bp
  • T to A, chromosome 10 at 24,049,941 bp
  • T to A, chromosome 10 at 127,090,965 bp
  • A to G, chromosome 11 at 4,487,536 bp
  • A to T, chromosome 11 at 28,583,400 bp
  • C to T, chromosome 11 at 66,525,327 bp
  • A to G, chromosome 11 at 68,385,543 bp
  • C to T, chromosome 11 at 74,335,099 bp
  • A to C, chromosome 11 at 116,768,930 bp
  • A to T, chromosome 12 at 8,010,136 bp
  • T to A, chromosome 12 at 76,072,207 bp
  • A to G, chromosome 12 at 84,934,253 bp
  • A to G, chromosome 13 at 93,094,869 bp
  • A to T, chromosome 14 at 20,309,783 bp
  • A to G, chromosome 14 at 31,159,008 bp
  • A to G, chromosome 15 at 27,606,295 bp
  • G to A, chromosome 15 at 31,585,442 bp
  • G to A, chromosome 15 at 101,924,646 bp
  • G to A, chromosome 16 at 3,980,089 bp
  • G to A, chromosome 16 at 22,411,708 bp
  • T to A, chromosome 17 at 33,962,117 bp
  • A to G, chromosome 17 at 38,175,447 bp
  • A to G, chromosome 17 at 43,037,877 bp
  • T to C, chromosome 17 at 65,985,681 bp
  • T to C, chromosome 17 at 85,032,845 bp
  • T to G, chromosome 17 at 86,805,848 bp
  • C to T, chromosome 17 at 87,717,476 bp
  • G to A, chromosome 18 at 37,519,160 bp
  • A to G, chromosome 18 at 62,937,097 bp
  • G to A, chromosome 18 at 89,010,955 bp
  • T to C, chromosome 19 at 31,664,196 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0363 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038569-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.