Strain Name:
C57BL/6J-MtgxR0363Btlr/Mmmh
Stock Number:
038569-MU
Citation ID:
RRID:MMRRC_038569-MU
Other Names:
R0363 (G1), C57BL/6J-MtgxR0363Btlr
Major Collection:

Strain Information

Mtmr3
Name: myotubularin related protein 3
Synonyms: ZFYVE10, 1700092A20Rik, FYVE-DSP1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74302
HGNC: HGNC:7451
Homologene: 23662
P2rx7
Name: purinergic receptor P2X, ligand-gated ion channel, 7
Synonyms: P2X(7), P2X7R, P2X7 receptor
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18439
HGNC: HGNC:8537
Homologene: 1925
Etv5
Name: ets variant 5
Synonyms: erm, 8430401F14Rik, 1110005E01Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 104156
HGNC: HGNC:3494
Homologene: 3276
Tmem87b
Name: transmembrane protein 87B
Synonyms: 2810431I02Rik, 2610301K12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72477
Homologene: 69513
Arhgap21
Name: Rho GTPase activating protein 21
Synonyms: ARHGAP10, 5530401C11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71435
Homologene: 10822
Ankrd12
Name: ankyrin repeat domain 12
Synonyms: 2900001A12Rik, GAC-1, ANCO-2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106585
Homologene: 9059
Prrc2c
Name: proline-rich coiled-coil 2C
Synonyms: 1810043M20Rik, Bat2d, Bat2l2, 9630039I18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226562
Homologene: 41015
Msh2
Name: mutS homolog 2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 17685
HGNC: HGNC:7325
Homologene: 210
Kmt2a
Name: lysine (K)-specific methyltransferase 2A
Synonyms: trithorax Drosophila, ALL-1, Mll, All1, HTRX1, Mll1, Cxxc7
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 214162
HGNC: HGNC:7132
Homologene: 4338
Plekha5
Name: pleckstrin homology domain containing, family A member 5
Synonyms: PEPP2, 2810431N21Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 109135
Homologene: 10377
Rttn
Name: rotatin
Synonyms: 4921538A15Rik, C530033I08Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 246102
VEGA: 18
Homologene: 65275
Isy1
Name: ISY1 splicing factor homolog
Synonyms: 5830446M03Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 57905
Homologene: 6283
Tnfrsf21
Name: tumor necrosis factor receptor superfamily, member 21
Synonyms: DR6, TR7, Death receptor 6
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 94185
VEGA: 17
Homologene: 8696
Arel1
Name: apoptosis resistant E3 ubiquitin protein ligase 1
Synonyms: 1110018G07Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 68497
Homologene: 8885
Fcho1
Name: FCH domain only 1
Synonyms: 3322402E17Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74015
Homologene: 22869
Abhd5
Name: abhydrolase domain containing 5
Synonyms: CGI-58, 2010002J10Rik, 1300003D03Rik, IECN5, NCIE2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67469
Homologene: 41088
Apob
Name: apolipoprotein B
Synonyms: apob-100, apob-48
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238055
HGNC: HGNC:603
Homologene: 328
Ntn1
Name: netrin 1
Synonyms: Netrin-1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18208
HGNC: HGNC:8029
Homologene: 21008
Ubr4
Name: ubiquitin protein ligase E3 component n-recognin 4
Synonyms: Zubr1, 1810009A16Rik, D930005K06Rik, LOC381562, p600, A930005E13Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69116
Homologene: 10804
Flvcr1
Name: feline leukemia virus subgroup C cellular receptor 1
Synonyms: Mfsd7b, 9630055N22Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226844
Homologene: 56661
Cuzd1
Name: CUB and zona pellucida-like domains 1
Synonyms: UTCZP, UO-44, ERG-1, Itmap1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16433
Homologene: 7389
Ino80
Name: INO80 complex subunit
Synonyms: 4632409L19Rik, Inoc1, INO80, 2310079N15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68142
Homologene: 75070
Chd6
Name: chromodomain helicase DNA binding protein 6
Synonyms: 5430439G14Rik, 6330406J24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71389
Homologene: 32772
Prkg1
Name: protein kinase, cGMP-dependent, type I
Synonyms: Prkg1b, Prkgr1b
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 19091
HGNC: HGNC:9414
Homologene: 55964
Trp73
Name: transformation related protein 73
Synonyms: TAp73, p73, deltaNp73
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22062
Homologene: 3960
Col1a2
Name: collagen, type I, alpha 2
Synonyms: Cola-2, Col1a-2, Cola2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12843
HGNC: HGNC:2198
Homologene: 69
Muc5ac
Name: mucin 5, subtypes A and C, tracheobronchial/gastric
Synonyms: MGM, 2210005L13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17833
HGNC: HGNC:7515
Homologene: 137237
Cmya5
Name: cardiomyopathy associated 5
Synonyms: Myospryn, 2310076E21Rik, 2310076E16Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 76469
VEGA: 13
Homologene: 137367
Syne2
Name: spectrin repeat containing, nuclear envelope 2
Synonyms: dice, syne-2, 6820443O06Rik, diminished cone electroretinogram, Cpfl8, D12Ertd777e, Nesp2g, nesprin-2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319565
Homologene: 56700
Ttll7
Name: tubulin tyrosine ligase-like family, member 7
Synonyms: 4921517B04Rik, 1110049N09Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 70892
Homologene: 41578
Il1rl1
Name: interleukin 1 receptor-like 1
Synonyms: T1/ST2, T1 gene, DER4, Fit-1, St2, T1, St2-rs1, ST2L, Ly84, ST2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17082
HGNC: HGNC:5998
Homologene: 2862
Fa2h
Name: fatty acid 2-hydroxylase
Synonyms: Faxdc1, G630055L08Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 338521
Homologene: 56284
Cntnap4
Name: contactin associated protein-like 4
Synonyms: Caspr4, E130114F09Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 170571
Homologene: 24912
Ciz1
Name: CDKN1A interacting zinc finger protein 1
Synonyms: 2900056O04Rik, 0610038H21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68379
Homologene: 8112
Slc3a1
Name: solute carrier family 3, member 1
Synonyms: D2H, NTAA
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20532
VEGA: 17
Homologene: 37289
Vmn1r58
Name: vomeronasal 1 receptor 58
Synonyms: V1rd4, V3R4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 81014
Homologene: 41799
Slx4
Name: SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)
Synonyms: Btbd12, D16Bwg1016e
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 52864
Homologene: 23770
Rp1
Name: retinitis pigmentosa 1 (human)
Synonyms: oxygen-regulated protein 1, Dcdc3, Rp1h, Orp1, mG145
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19888
Homologene: 4564
Krt4
Name: keratin 4
Synonyms: K4, Krt-2.4, Krt2-4
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16682
VEGA: 15
HGNC: HGNC:6441
Homologene: 20523
Sycp2
Name: synaptonemal complex protein 2
Synonyms: 4930518F03Rik, 3830402K23Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 320558
Homologene: 8604
Epas1
Name: endothelial PAS domain protein 1
Synonyms: HIF2A, bHLHe73, hypoxia inducible transcription factor 2alpha, MOP2, HIF-2alpha, HLF, HRF, Hif like protein
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13819
VEGA: 17
HGNC: HGNC:3374
Homologene: 1095
Stab1
Name: stabilin 1
Synonyms: MS-1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 192187
Homologene: 9035
Pcdhb22
Name: protocadherin beta 22
Synonyms: Pcdhb15, PcdhbV
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93893
HGNC: HGNC:8686
Homologene: 113752
Inpp4b
Name: inositol polyphosphate-4-phosphatase, type II
Synonyms: E130107I17Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234515
HGNC: HGNC:6075
Homologene: 20832
Agap2
Name: ArfGAP with GTPase domain, ankyrin repeat and PH domain 2
Synonyms: Centg1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216439
VEGA: 10
Homologene: 86815
Map1a
Name: microtubule-associated protein 1 A
Synonyms: Mtap1a, Mtap1, 6330416M19Rik, Mtap-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17754
HGNC: HGNC:6835
Homologene: 1778
Taar7f
Name: trace amine-associated receptor 7F
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 435207
Homologene: 134040
Dnah7b
Name: dynein, axonemal, heavy chain 7B
Synonyms: Dnahc7b, LOC227058
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227058
Homologene: 41287
St6galnac1
Name: ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 1
Synonyms: ST6GalNAc I, Siat7a
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20445
Homologene: 7937
Ppip5k1
Name: diphosphoinositol pentakisphosphate kinase 1
Synonyms: Hisppd2a, B430315C20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 327655
Homologene: 49395
4832428D23Rik
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Cntnap5b
Name: contactin associated protein-like 5B
Synonyms: C230078M14Rik, Caspr5-2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241175
Homologene: 104295
Apcdd1
Name: adenomatosis polyposis coli down-regulated 1
Synonyms: Drapc1, EIG180
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 494504
VEGA: 18
Homologene: 77420
Or5p73
Name: olfactory receptor family 5 subfamily P member 73
Synonyms: MOR204-36, GA_x6K02T2PBJ9-10795522-10796514, Olfr498
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258304
Homologene: 133600
Or2n1
Name: olfactory receptor family 2 subfamily N member 1
Synonyms: GA_x6K02T2PSCP-2623613-2624551, Olfr134, MOR256-5
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258829
Homologene: 110603
Otulin
Name: OTU deubiquitinase with linear linkage specificity
Synonyms: gumby, Fam105b, m7-1Sapc, m3Sapc
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 432940
VEGA: 15
Homologene: 106591
Pramel14
Name: PRAME like 14
Synonyms: Gm13107, Pramef17
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 626943
Homologene: 129642
Ssrp1
Name: structure specific recognition protein 1
Synonyms: Hmgi-rs3, T160, Hmgox, Hmg1-rs1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20833
Homologene: 110735
Nudt13
Name: nudix hydrolase 13
Synonyms: nudix (nucleoside diphosphate linked moiety X)-type motif 13, 4933433B15Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 67725
VEGA: 14
Homologene: 22936
Or4b1b
Name: olfactory receptor family 4 subfamily B member 1B
Synonyms: GA_x6K02T2Q125-51636504-51635578, Olfr1272, MOR227-3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258982
HGNC: HGNC:8290
Homologene: 133649
Ttl
Name: tubulin tyrosine ligase
Synonyms: 2700049H19Rik, 2410003M22Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69737
Homologene: 32678
Pltp
Name: phospholipid transfer protein
Synonyms: Bpife, OD107
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18830
HGNC: HGNC:9093
Homologene: 4536
Prdm13
Name: PR domain containing 13
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230025
Homologene: 11000
Dlgap3
Name: DLG associated protein 3
Synonyms: Prpl8, SAP90/PSD 95 associated protein 3, DAP3, Sapap3, PSD-95/SAP90-binding protein 3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242667
Homologene: 18276
Cyp3a16
Name: cytochrome P450, family 3, subfamily a, polypeptide 16
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13114
HGNC: HGNC:2638
Homologene: 133568
Abhd2
Name: abhydrolase domain containing 2
Synonyms: LABH2, 2210009N18Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 54608
Homologene: 23121
Ap1m1
Name: adaptor-related protein complex AP-1, mu subunit 1
Synonyms: mu1A, Cltnm, [m]1A, AP47, Adtm1A
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11767
Homologene: 4017
Tlcd5
Name: TLC domain containing 5
Synonyms: LOC235300, Tmem136
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235300
VEGA: 9
Homologene: 72560
Ccdc85a
Name: coiled-coil domain containing 85A
Synonyms: E030025D05Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216613
Homologene: 65605
Shisa6
Name: shisa family member 6
Synonyms: LOC380702, CKAMP52, Gm879
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380702
Homologene: 66164
Or3a1
Name: olfactory receptor family 3 subfamily A member 1
Synonyms: MOR255-5, GA_x6K02T2P1NL-4467421-4466474, Olfr410
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258702
Homologene: 68262
Cmbl
Name: carboxymethylenebutenolidase homolog
Synonyms: 2310016A09Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 69574
Homologene: 100714
Vps52
Name: VPS52 GARP complex subunit
Synonyms: ARE1, Sacm2l, tcl-w5, tclw5, D430041K17Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224705
Homologene: 5756
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 4,347,718 bp
  • CTTGTTGTTGTTGTTGTTG to CTTGTTGTTGTTGTTGTTGTTG, chromosome 1 at 40,442,574 bp
  • A to G, chromosome 1 at 44,211,030 bp
  • T to C, chromosome 1 at 46,236,788 bp
  • A to G, chromosome 1 at 100,274,468 bp
  • A to G, chromosome 1 at 162,697,811 bp
  • T to A, chromosome 1 at 191,012,254 bp
  • C to A, chromosome 2 at 20,881,133 bp
  • G to C, chromosome 2 at 32,377,363 bp
  • T to G, chromosome 2 at 85,040,674 bp
  • A to T, chromosome 2 at 90,281,856 bp
  • G to A, chromosome 2 at 119,382,960 bp
  • T to C, chromosome 2 at 121,302,044 bp
  • C to G, chromosome 2 at 121,347,355 bp
  • T to A, chromosome 2 at 128,831,233 bp
  • A to G, chromosome 2 at 129,076,061 bp
  • A to G, chromosome 2 at 161,014,324 bp
  • C to T, chromosome 2 at 164,840,136 bp
  • T to C, chromosome 2 at 178,346,411 bp
  • T to C, chromosome 3 at 146,944,215 bp
  • A to C, chromosome 4 at 21,679,737 bp
  • T to A, chromosome 4 at 109,524,323 bp
  • A to G, chromosome 4 at 127,235,521 bp
  • A to G, chromosome 4 at 139,391,860 bp
  • C to T, chromosome 4 at 143,991,651 bp
  • A to G, chromosome 4 at 154,063,949 bp
  • T to C, chromosome 5 at 109,676,888 bp
  • C to T, chromosome 5 at 122,657,030 bp
  • T to C, chromosome 5 at 145,455,879 bp
  • G to A, chromosome 6 at 4,518,822 bp
  • G to A, chromosome 6 at 87,819,185 bp
  • G to A, chromosome 6 at 140,591,747 bp
  • A to T, chromosome 7 at 5,410,637 bp
  • A to G, chromosome 7 at 79,350,813 bp
  • A to T, chromosome 7 at 108,465,734 bp
  • A to T, chromosome 7 at 131,316,262 bp
  • A to T, chromosome 7 at 141,800,960 bp
  • T to C, chromosome 8 at 71,717,490 bp
  • T to C, chromosome 8 at 72,252,894 bp
  • T to C, chromosome 8 at 72,256,724 bp
  • T to C, chromosome 8 at 81,884,257 bp
  • T to A, chromosome 8 at 111,349,289 bp
  • A to T, chromosome 8 at 112,856,511 bp
  • A to T, chromosome 9 at 43,111,753 bp
  • A to G, chromosome 9 at 44,809,713 bp
  • T to C, chromosome 9 at 122,368,146 bp
  • T to A, chromosome 10 at 24,049,941 bp
  • T to A, chromosome 10 at 127,090,965 bp
  • A to G, chromosome 11 at 4,487,536 bp
  • A to T, chromosome 11 at 28,583,400 bp
  • C to T, chromosome 11 at 66,525,327 bp
  • A to G, chromosome 11 at 68,385,543 bp
  • C to T, chromosome 11 at 74,335,099 bp
  • A to C, chromosome 11 at 116,768,930 bp
  • A to T, chromosome 12 at 8,010,136 bp
  • T to A, chromosome 12 at 76,072,207 bp
  • A to G, chromosome 12 at 84,934,253 bp
  • A to G, chromosome 13 at 93,094,869 bp
  • A to T, chromosome 14 at 20,309,783 bp
  • A to G, chromosome 14 at 31,159,008 bp
  • A to G, chromosome 15 at 27,606,295 bp
  • G to A, chromosome 15 at 31,585,442 bp
  • G to A, chromosome 15 at 101,924,646 bp
  • G to A, chromosome 16 at 3,980,089 bp
  • G to A, chromosome 16 at 22,411,708 bp
  • T to A, chromosome 17 at 33,962,117 bp
  • A to G, chromosome 17 at 38,175,447 bp
  • A to G, chromosome 17 at 43,037,877 bp
  • T to C, chromosome 17 at 65,985,681 bp
  • T to C, chromosome 17 at 85,032,845 bp
  • T to G, chromosome 17 at 86,805,848 bp
  • C to T, chromosome 17 at 87,717,476 bp
  • G to A, chromosome 18 at 37,519,160 bp
  • A to G, chromosome 18 at 62,937,097 bp
  • G to A, chromosome 18 at 89,010,955 bp
  • T to C, chromosome 19 at 31,664,196 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0363 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038569-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.