Strain Name:
C57BL/6J-MtgxR0567Btlr/Mmmh
Stock Number:
038758-MU
Citation ID:
RRID:MMRRC_038758-MU
Other Names:
R0567 (G1), C57BL/6J-MtgxR0567Btlr
Major Collection:

Strain Information

Rbpms2
Name: RNA binding protein with multiple splicing 2
Synonyms: 2400008B06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 71973
VEGA: 9
Homologene: 49895
Fryl
Name: FRY like transcription coactivator
Synonyms: 2310004H21Rik, 2510002A14Rik, 9030227G01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 72313
Homologene: 103956
Shroom3
Name: shroom family member 3
Synonyms: Shrm, D5Ertd287e, Shrm3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 27428
Homologene: 9263
Denr
Name: density-regulated protein
Synonyms: 1500003K04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 68184
HGNC: HGNC:2769
Homologene: 6275
Uaca
Name: uveal autoantigen with coiled-coil domains and ankyrin repeats
Synonyms: 2700059D02Rik, nucling
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 72565
VEGA: 9
Homologene: 74297
Atr
Name: ataxia telangiectasia and Rad3 related
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 245000
HGNC: HGNC:882
Homologene: 96916
Heatr5a
Name: HEAT repeat containing 5A
Synonyms: D930036F22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 320487
VEGA: 12
Homologene: 19635
Rad50
Name: RAD50 double strand break repair protein
Synonyms: Mrell, Rad50l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 19360
HGNC: HGNC:9816
Homologene: 38092
Taf6
Name: TATA-box binding protein associated factor 6
Synonyms: p80, 80kDa, Taf2e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 21343
Homologene: 7561
Dsp
Name: desmoplakin
Synonyms: rul, 2300002E22Rik, 5730453H04Rik, DP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 109620
HGNC: HGNC:3052
Homologene: 37922
Or4m1
Name: olfactory receptor family 4 subfamily M member 1
Synonyms: MOR242-1, GA_x6K02T2PMLR-6013665-6012724, Olfr734
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 258658
Homologene: 51759
Egfr
Name: epidermal growth factor receptor
Synonyms: 9030024J15Rik, Erbb, Wa5, avian erythroblastic leukemia viral (v-erb-b) oncogene homolog, Errb1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 13649
HGNC: HGNC:3236
Homologene: 74545
Adamtsl1
Name: ADAMTS-like 1
Synonyms: 5930437A14Rik, punctin-1, 6720426B09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 77739
Homologene: 64642
Oit3
Name: oncoprotein induced transcript 3
Synonyms: EF-9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 18302
Homologene: 7870
AW554918
Name: expressed sequence AW554918
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 225289
Homologene: 52652
Tbc1d32
Name: TBC1 domain family, member 32
Synonyms: D630037F22Rik, Bromi, b2b2284Clo, C6orf170
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 544696
VEGA: 10
Homologene: 51889
Stxbp2
Name: syntaxin binding protein 2
Synonyms: Munc-18-2, muSec1, Munc18b, Sxtp2, C79054, Munc-18b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 20911
Homologene: 55530
Syne2
Name: spectrin repeat containing, nuclear envelope 2
Synonyms: diminished cone electroretinogram, Nesp2g, Cpfl8, 6820443O06Rik, D12Ertd777e, syne-2, nesprin-2, dice
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 319565
Homologene: 56700
Lama3
Name: laminin, alpha 3
Synonyms: [a]3B, nicein, 150kDa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 16774
HGNC: HGNC:6483
Homologene: 18279
Myh7b
Name: myosin, heavy chain 7B, cardiac muscle, beta
Synonyms: Myh14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 668940
Homologene: 66117
Zscan20
Name: zinc finger and SCAN domains 20
Synonyms: Zfp31
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 269585
Homologene: 51463
Usp17le
Name: ubiquitin specific peptidase 17-like E
Synonyms: Dub3, Gm6596
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 625530
Homologene: 131315
Ceacam10
Name: CEA cell adhesion molecule 10
Synonyms: Bgp3, Cea10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 26366
Vmn2r80
Name: vomeronasal 2, receptor 80
Synonyms: EG624765
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 624765
Homologene: 83483
C1galt1
Name: core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase, 1
Synonyms: 2210410E06Rik, T-synthase, core 1 beta3-Gal-T
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 94192
Homologene: 10599
Lipg
Name: lipase, endothelial
Synonyms: mEDL, 3110013K01Rik, EL, endothelial lipase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 16891
VEGA: 18
HGNC: HGNC:6623
Homologene: 21218
Col15a1
Name: collagen, type XV, alpha 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 12819
HGNC: HGNC:2192
Homologene: 1396
Rab26
Name: RAB26, member RAS oncogene family
Synonyms: A830020M03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 328778
Homologene: 25655
Slc14a2
Name: solute carrier family 14 (urea transporter), member 2
Synonyms: UT-A3, UT-A5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 27411
VEGA: 18
Homologene: 5183
Apcdd1
Name: adenomatosis polyposis coli down-regulated 1
Synonyms: Drapc1, EIG180
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 494504
VEGA: 18
Homologene: 77420
Doc2b
Name: double C2, beta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 13447
HGNC: HGNC:2986
Homologene: 20796
Cyp3a11
Name: cytochrome P450, family 3, subfamily a, polypeptide 11
Synonyms: Pcn, IIIAm1, Cyp3a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 13112
Homologene: 133568
Yju2b
Name: YJU2 splicing factor homolog B
Synonyms: 4930527D15Rik, Ccdc130
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 67736
Homologene: 12183
Pyroxd2
Name: pyridine nucleotide-disulphide oxidoreductase domain 2
Synonyms: 3830409H07Rik, 4833409A17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 74580
VEGA: 19
Homologene: 13097
CT030661.1
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Vmn1r71
Name: vomeronasal 1 receptor 71
Synonyms: V1re13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 252910
Homologene: 74352
Akr1b1
Name: aldo-keto reductase family 1 member B
Synonyms: Aldr1, Akr1b3, Ahr-1, Aldor1, AR, Ahr1, ALR2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 11677
HGNC: HGNC:381
Homologene: 133743
Gm15854
Name: predicted gene 15854
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 667764
Homologene: 110821
P2ry2
Name: purinergic receptor P2Y, G-protein coupled 2
Synonyms: P2Y2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 18442
HGNC: HGNC:8541
Homologene: 1927
Alox8
Name: arachidonate 8-lipoxygenase
Synonyms: 8S-lipoxygenase, 8-LOX, 8S-LOX, Alox15b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 11688
HGNC: HGNC:434
Homologene: 886
AC073939.1
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
H2ac12
Name: H2A clustered histone 12
Synonyms: Hist1h2ah
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 319168
HGNC: HGNC:4734
Homologene: 119667
Gstp3
Name: glutathione S-transferase pi 3
Synonyms: BC021614
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 225884
Homologene: 129928
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 2 at 155,626,398 bp
  • G to T, chromosome 4 at 47,293,231 bp
  • A to G, chromosome 4 at 86,228,016 bp
  • A to G, chromosome 4 at 128,589,450 bp
  • C to T, chromosome 5 at 73,065,391 bp
  • A to G, chromosome 5 at 92,964,453 bp
  • C to T, chromosome 5 at 123,908,158 bp
  • A to T, chromosome 5 at 138,183,726 bp
  • G to A, chromosome 5 at 145,869,149 bp
  • A to G, chromosome 6 at 7,866,874 bp
  • A to T, chromosome 6 at 34,304,345 bp
  • A to G, chromosome 6 at 129,988,118 bp
  • T to C, chromosome 7 at 10,748,629 bp
  • T to A, chromosome 7 at 24,778,409 bp
  • T to C, chromosome 7 at 100,998,541 bp
  • C to T, chromosome 7 at 104,768,898 bp
  • C to A, chromosome 8 at 3,641,210 bp
  • A to G, chromosome 8 at 84,260,665 bp
  • A to G, chromosome 9 at 60,871,381 bp
  • ACTGCTGCTGCTGCTGC to ACTGCTGCTGCTGCTGCTGC, chromosome 9 at 65,651,666 bp
  • T to C, chromosome 9 at 95,865,829 bp
  • A to T, chromosome 10 at 56,173,963 bp
  • A to T, chromosome 10 at 59,435,978 bp
  • A to G, chromosome 10 at 79,194,831 bp
  • A to T, chromosome 11 at 16,872,873 bp
  • C to T, chromosome 11 at 53,654,956 bp
  • A to T, chromosome 11 at 69,191,522 bp
  • A to G, chromosome 11 at 75,780,124 bp
  • T to A, chromosome 12 at 51,910,089 bp
  • G to A, chromosome 12 at 75,890,230 bp
  • C to T, chromosome 12 at 115,623,549 bp
  • T to C, chromosome 13 at 22,035,564 bp
  • A to T, chromosome 13 at 38,192,438 bp
  • A to T, chromosome 14 at 50,320,658 bp
  • T to C, chromosome 17 at 22,200,468 bp
  • C to A, chromosome 17 at 24,529,582 bp
  • A to G, chromosome 18 at 12,542,460 bp
  • A to G, chromosome 18 at 12,549,252 bp
  • G to A, chromosome 18 at 25,400,035 bp
  • G to A, chromosome 18 at 62,934,036 bp
  • A to T, chromosome 18 at 74,957,369 bp
  • G to T, chromosome 18 at 78,184,177 bp
  • A to T, chromosome 19 at 4,057,636 bp
  • T to C, chromosome 19 at 42,735,925 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0567 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038758-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.