Strain Name:
C57BL/6J-MtgxR0670Btlr/Mmmh
Stock Number:
038855-MU
Citation ID:
RRID:MMRRC_038855-MU
Other Names:
R0670 (G1), C57BL/6J-MtgxR0670Btlr
Major Collection:

Strain Information

a
Name: nonagouti
Synonyms: ASP, agouti signal protein, agouti, As
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 50518
HGNC: HGNC:745
Homologene: 1264
Ap4e1
Name: adaptor-related protein complex AP-4, epsilon 1
Synonyms: 2310033A20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 108011
HGNC: HGNC:573
Homologene: 22397
Xrn1
Name: 5'-3' exoribonuclease 1
Synonyms: Dhm2, mXrn1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 24127
Homologene: 5894
Vps13c
Name: vacuolar protein sorting 13C
Synonyms: C230055H22Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320528
VEGA: 9
Homologene: 41188
Pkn2
Name: protein kinase N2
Synonyms: 6030436C20Rik, Stk7, Prkcl2, PRK2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109333
HGNC: HGNC:9406
Homologene: 2054
Ranbp2
Name: RAN binding protein 2
Synonyms: A430087B05Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19386
VEGA: 10
Homologene: 87808
Gsk3b
Name: glycogen synthase kinase 3 beta
Synonyms: GSK3, 7330414F15Rik, 8430431H08Rik, GSK-3beta, GSK-3
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 56637
HGNC: HGNC:4617
Homologene: 55629
Nfrkb
Name: nuclear factor related to kappa B binding protein
Synonyms: A530090G11Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235134
HGNC: HGNC:7802
Homologene: 4492
Stk39
Name: serine/threonine kinase 39
Synonyms: SPAK, DCHT, RF005, Rnl5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 53416
Homologene: 22739
Brms1
Name: breast cancer metastasis-suppressor 1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107392
VEGA: 19
Homologene: 32260
Hspbp1
Name: HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1
Synonyms: 1500019G21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66245
Homologene: 40827
Ahcyl1
Name: S-adenosylhomocysteine hydrolase-like 1
Synonyms: 1110034F20Rik, DCAL, IRBIT, Ahcy-rs3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229709
HGNC: HGNC:344
Homologene: 77353
Treml2
Name: triggering receptor expressed on myeloid cells-like 2
Synonyms: LOC328833
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 328833
VEGA: 17
Homologene: 81906
Dnhd1
Name: dynein heavy chain domain 1
Synonyms: 8030491N06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 77505
Homologene: 131117
Klhl6
Name: kelch-like 6
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239743
Homologene: 15603
Ttn
Name: titin
Synonyms: shru, L56, mdm, connectin, D330041I19Rik, 2310057K23Rik, 2310074I15Rik, 2310036G12Rik, D830007G01Rik, 1100001C23Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Otop1
Name: otopetrin 1
Synonyms: tlt, A530025J20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 21906
Homologene: 35244
Kif17
Name: kinesin family member 17
Synonyms: Kif17b, 5930435E01Rik, N-4 kinesin
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16559
Homologene: 5883
Elmod1
Name: ELMO/CED-12 domain containing 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270162
VEGA: 9
Homologene: 10280
Neb
Name: nebulin
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17996
HGNC: HGNC:7720
Homologene: 136285
Nat8f5
Name: N-acetyltransferase 8 (GCN5-related) family member 5
Synonyms: 1810018F03Rik, Cml5
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 69049
Homologene: 87019
Gm8909
Name: predicted gene 8909
Synonyms: Gm8909
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 667977
Homologene: 128352
Afap1l2
Name: actin filament associated protein 1-like 2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226250
Homologene: 13057
Abraxas2
Name: BRISC complex subunit
Synonyms: KIAA0157, C430003P19Rik, Fam175b
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 109359
Homologene: 12970
Vrk2
Name: vaccinia related kinase 2
Synonyms: 2810003O05Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69922
Homologene: 55966
Pcdhb2
Name: protocadherin beta 2
Synonyms: PcdhbB
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93873
HGNC: HGNC:8687
Homologene: 69266
Tlr5
Name: toll-like receptor 5
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 53791
Homologene: 20698
Col25a1
Name: collagen, type XXV, alpha 1
Synonyms: 2700062B08Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 77018
Homologene: 57111
Crisp1
Name: cysteine-rich secretory protein 1
Synonyms: CRISP-1, Aeg1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 11571
Homologene: 135665
Harbi1
Name: harbinger transposase derived 1
Synonyms: D230010M03Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241547
Homologene: 24535
Muc1
Name: mucin 1, transmembrane
Synonyms: CD227, EMA, Muc-1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 17829
HGNC: HGNC:7508
Homologene: 137248
Celf3
Name: CUGBP, Elav-like family member 3
Synonyms: BRUNOL1, Tnrc4, ERDA4, CAGH4, 4930415M08Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 78784
Homologene: 48510
Gmfg
Name: glia maturation factor, gamma
Synonyms: 0610039G16Rik, 2310057N07Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 63986
HGNC: HGNC:4374
Homologene: 37978
Pdilt
Name: protein disulfide isomerase-like, testis expressed
Synonyms: 1700007B13Rik, PDILT
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71830
Homologene: 18382
Vmn1r-ps123
Name: vomeronasal 1 receptor, pseudogene 123
Synonyms: Gm11044
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 100312552
Socs1
Name: suppressor of cytokine signaling 1
Synonyms: STAT-induced STAT inhibitor 1, SSI-1, Cish1, Cish7, SOCS-1, JAB, JAK2-binding protein, JAK-binding protein
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12703
VEGA: 16
Homologene: 2776
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 182,973,889 bp
  • A to G, chromosome 2 at 52,256,124 bp
  • T to C, chromosome 2 at 68,366,182 bp
  • A to G, chromosome 2 at 76,749,104 bp
  • C to T, chromosome 2 at 91,712,535 bp
  • T to A, chromosome 2 at 127,011,864 bp
  • A to T, chromosome 2 at 155,045,758 bp
  • A to G, chromosome 3 at 89,230,532 bp
  • ACAGCAGCAGCAGCAGCAGCAGCA to ACAGCAGCAGCAGCAGCAGCA, chromosome 3 at 94,488,230 bp
  • A to T, chromosome 3 at 107,671,165 bp
  • A to G, chromosome 3 at 130,386,895 bp
  • A to T, chromosome 3 at 142,839,343 bp
  • A to T, chromosome 4 at 138,262,499 bp
  • T to C, chromosome 5 at 38,287,948 bp
  • A to T, chromosome 6 at 85,817,975 bp
  • A to G, chromosome 7 at 4,677,736 bp
  • T to A, chromosome 7 at 28,441,528 bp
  • A to T, chromosome 7 at 105,696,464 bp
  • T to C, chromosome 7 at 119,500,428 bp
  • A to T, chromosome 7 at 132,869,031 bp
  • A to T, chromosome 9 at 31,420,173 bp
  • A to G, chromosome 9 at 53,912,822 bp
  • G to T, chromosome 9 at 67,925,857 bp
  • A to G, chromosome 9 at 95,991,056 bp
  • C to A, chromosome 10 at 58,480,698 bp
  • C to T, chromosome 11 at 26,486,959 bp
  • C to T, chromosome 13 at 22,996,317 bp
  • A to T, chromosome 15 at 76,205,960 bp
  • A to G, chromosome 16 at 10,784,262 bp
  • T to A, chromosome 16 at 19,949,559 bp
  • G to T, chromosome 16 at 38,144,316 bp
  • G to C, chromosome 17 at 36,168,098 bp
  • A to C, chromosome 17 at 40,305,110 bp
  • A to G, chromosome 17 at 48,307,836 bp
  • A to T, chromosome 18 at 37,296,648 bp
  • C to A, chromosome 19 at 5,045,971 bp
  • G to A, chromosome 19 at 56,915,803 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0670 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038855-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.