Strain Name:
C57BL/6J-MtgxR0670Btlr/Mmmh
Stock Number:
038855-MU
Citation ID:
RRID:MMRRC_038855-MU
Other Names:
R0670 (G1), C57BL/6J-MtgxR0670Btlr
Major Collection:

Gene Information

Gene Symbol: a [MGI:87853] (Mus musculus (mouse))
Name: nonagouti
Synonyms: agouti, As, agouti signal protein, ASP
Chromosome: 2
Alteration at locus: Chemically Induced
Gene Symbol: Ap4e1 [MGI:1336993] (Mus musculus (mouse))
Name: adaptor-related protein complex AP-4, epsilon 1
Synonyms: 2310033A20Rik
Chromosome: 2
Alteration at locus: Chemically Induced
Gene Symbol: Xrn1 [MGI:891964] (Mus musculus (mouse))
Name: 5'-3' exoribonuclease 1
Synonyms: Dhm2, mXrn1
Chromosome: 9
Alteration at locus: Chemically Induced
Gene Symbol: Vps13c [MGI:2444207] (Mus musculus (mouse))
Name: vacuolar protein sorting 13C
Synonyms: C230055H22Rik
Chromosome: 9
Alteration at locus: Chemically Induced
Gene Symbol: Pkn2 [MGI:109211] (Mus musculus (mouse))
Name: protein kinase N2
Synonyms: Stk7, 6030436C20Rik, Prkcl2, PRK2
Chromosome: 3
Alteration at locus: Chemically Induced
Gene Symbol: Ranbp2 [MGI:894323] (Mus musculus (mouse))
Name: RAN binding protein 2
Synonyms: A430087B05Rik
Chromosome: 10
Alteration at locus: Chemically Induced
Gene Symbol: Gsk3b [MGI:1861437] (Mus musculus (mouse))
Name: glycogen synthase kinase 3 beta
Synonyms: 8430431H08Rik, GSK3, 7330414F15Rik, GSK-3, GSK-3beta
Chromosome: 16
Alteration at locus: Chemically Induced
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 182,973,889 bp
  • A to G, chromosome 2 at 52,256,124 bp
  • T to C, chromosome 2 at 68,366,182 bp
  • A to G, chromosome 2 at 76,749,104 bp
  • C to T, chromosome 2 at 91,712,535 bp
  • T to A, chromosome 2 at 127,011,864 bp
  • A to T, chromosome 2 at 155,045,758 bp
  • A to G, chromosome 3 at 89,230,532 bp
  • ACAGCAGCAGCAGCAGCAGCAGCA to ACAGCAGCAGCAGCAGCAGCA, chromosome 3 at 94,488,230 bp
  • A to T, chromosome 3 at 107,671,165 bp
  • A to G, chromosome 3 at 130,386,895 bp
  • A to T, chromosome 3 at 142,839,343 bp
  • A to T, chromosome 4 at 138,262,499 bp
  • T to C, chromosome 5 at 38,287,948 bp
  • A to T, chromosome 6 at 85,817,975 bp
  • A to G, chromosome 7 at 4,677,736 bp
  • T to A, chromosome 7 at 28,441,528 bp
  • A to T, chromosome 7 at 105,696,464 bp
  • T to C, chromosome 7 at 119,500,428 bp
  • A to T, chromosome 7 at 132,869,031 bp
  • A to T, chromosome 9 at 31,420,173 bp
  • A to G, chromosome 9 at 53,912,822 bp
  • G to T, chromosome 9 at 67,925,857 bp
  • A to G, chromosome 9 at 95,991,056 bp
  • C to A, chromosome 10 at 58,480,698 bp
  • C to T, chromosome 11 at 26,486,959 bp
  • C to T, chromosome 13 at 22,996,317 bp
  • A to T, chromosome 15 at 76,205,960 bp
  • A to G, chromosome 16 at 10,784,262 bp
  • T to A, chromosome 16 at 19,949,559 bp
  • G to T, chromosome 16 at 38,144,316 bp
  • G to C, chromosome 17 at 36,168,098 bp
  • A to C, chromosome 17 at 40,305,110 bp
  • A to G, chromosome 17 at 48,307,836 bp
  • A to T, chromosome 18 at 37,296,648 bp
  • C to A, chromosome 19 at 5,045,971 bp
  • G to A, chromosome 19 at 56,915,803 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0670 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
038855-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter1; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

3 An aliquot contains a sufficient number of embryos (in one or more vials and based on the transfer success rate of the MMRRC facility) to transfer to at least two recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.