Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1172Btlr/Mmmh
Stock Number:
039245-MU
Citation ID:
RRID:MMRRC_039245-MU
Other Names:
R1172 (G1), C57BL/6J-MtgxR1172Btlr
Major Collection:

Strain Information

Tyrp1
Name: tyrosinase-related protein 1
Synonyms: Tyrp, isa, TRP-1, TRP1, Oca3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22178
Homologene: 464
Npr1
Name: natriuretic peptide receptor 1
Synonyms: NPRA, GC-A, NPR-A, guanylyl cyclase-A
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18160
HGNC: HGNC:7943
Homologene: 37367
Map7
Name: microtubule-associated protein 7
Synonyms: E-MAP-115, mste, ste, mshi, Mtap7
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17761
VEGA: 10
HGNC: HGNC:6869
Homologene: 20851
Rpa1
Name: replication protein A1
Synonyms: Rpa, RF-A, RP-A, 5031405K23Rik, 70kDa
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68275
Homologene: 2208
Ubap2l
Name: ubiquitin-associated protein 2-like
Synonyms: 3110083O19Rik, NICE-4, 4932431F02Rik, A430103N23Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74383
Homologene: 136291
Epc1
Name: enhancer of polycomb homolog 1
Synonyms: 5730566F07Rik, 2400007E14Rik, A930032N02Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13831
Homologene: 32627
Pcnt
Name: pericentrin (kendrin)
Synonyms: Pcnt2, m275Asp, m239Asp
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18541
VEGA: 10
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 44,126,782 bp
  • A to G, chromosome 1 at 55,211,217 bp
  • G to T, chromosome 1 at 65,161,160 bp
  • A to T, chromosome 1 at 153,166,287 bp
  • A to T, chromosome 2 at 53,072,274 bp
  • A to T, chromosome 2 at 93,866,244 bp
  • C to T, chromosome 2 at 98,663,907 bp
  • A to T, chromosome 2 at 125,394,687 bp
  • A to T, chromosome 3 at 90,023,500 bp
  • T to A, chromosome 3 at 90,461,382 bp
  • C to A, chromosome 4 at 35,218,630 bp
  • C to T, chromosome 4 at 80,844,868 bp
  • A to T, chromosome 4 at 94,638,389 bp
  • T to C, chromosome 4 at 98,765,569 bp
  • A to T, chromosome 4 at 111,656,318 bp
  • T to C, chromosome 4 at 129,620,889 bp
  • G to A, chromosome 4 at 146,537,764 bp
  • A to T, chromosome 5 at 21,620,604 bp
  • A to T, chromosome 5 at 31,168,075 bp
  • A to G, chromosome 5 at 43,825,408 bp
  • G to A, chromosome 5 at 122,251,689 bp
  • T to C, chromosome 5 at 150,051,556 bp
  • G to A, chromosome 5 at 150,481,494 bp
  • G to T, chromosome 6 at 142,756,878 bp
  • T to A, chromosome 7 at 4,338,121 bp
  • T to C, chromosome 7 at 58,803,766 bp
  • T to C, chromosome 7 at 81,559,770 bp
  • G to T, chromosome 7 at 85,005,591 bp
  • T to A, chromosome 7 at 85,751,944 bp
  • A to T, chromosome 7 at 96,848,044 bp
  • A to G, chromosome 7 at 120,730,522 bp
  • T to C, chromosome 8 at 94,031,129 bp
  • G to T, chromosome 9 at 105,663,174 bp
  • CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA to CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA, chromosome 9 at 119,160,716 bp
  • A to G, chromosome 10 at 17,842,756 bp
  • G to A, chromosome 10 at 20,056,648 bp
  • G to A, chromosome 10 at 20,245,299 bp
  • A to G, chromosome 10 at 21,304,638 bp
  • G to A, chromosome 10 at 40,737,708 bp
  • A to T, chromosome 10 at 76,393,044 bp
  • C to A, chromosome 10 at 112,083,466 bp
  • T to C, chromosome 10 at 130,477,584 bp
  • A to G, chromosome 11 at 29,749,824 bp
  • A to T, chromosome 11 at 75,312,393 bp
  • T to C, chromosome 12 at 8,936,716 bp
  • T to C, chromosome 12 at 21,395,023 bp
  • T to A, chromosome 12 at 84,679,168 bp
  • A to G, chromosome 13 at 24,957,566 bp
  • A to T, chromosome 13 at 81,557,063 bp
  • T to C, chromosome 14 at 45,459,968 bp
  • T to C, chromosome 14 at 51,315,891 bp
  • T to G, chromosome 14 at 68,514,921 bp
  • T to C, chromosome 14 at 69,191,985 bp
  • T to A, chromosome 14 at 70,652,221 bp
  • C to T, chromosome 15 at 73,605,429 bp
  • A to G, chromosome 15 at 82,031,163 bp
  • A to T, chromosome 15 at 97,869,333 bp
  • T to C, chromosome 16 at 52,186,240 bp
  • T to A, chromosome 17 at 5,339,300 bp
  • A to C, chromosome 18 at 6,490,525 bp
  • A to T, chromosome X at 72,999,323 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1172 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039245-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.