Strain Name:
C57BL/6J-MtgxR1374Btlr/Mmmh
Stock Number:
039438-MU
Citation ID:
RRID:MMRRC_039438-MU
Other Names:
R1374 (G1), C57BL/6J-MtgxR1374Btlr
Major Collection:

Gene Information

Zmym1
Name: zinc finger, MYM domain containing 1
Synonyms: 5830412B09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 68310
Homologene: 32904
Sae1
Name: SUMO1 activating enzyme subunit 1
Synonyms: 2400010M20Rik, AOS1, HSPC140, SUMO-1 activating enzyme subunit 1, Uble1a, D7Ertd177e, 2610044L12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 56459
Homologene: 4019
Rbpms2
Name: RNA binding protein with multiple splicing 2
Synonyms: 2400008B06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 71973
VEGA: 9
Homologene: 49895
Rapgef2
Name: Rap guanine nucleotide exchange factor (GEF) 2
Synonyms: CNRasGEF, Pdzgef1, 5830453M24Rik, RA-GEF-1, nRapGEP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 76089
Homologene: 35477
Prr12
Name: proline rich 12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233210
Homologene: 18957
Ppfibp2
Name: PTPRF interacting protein, binding protein 2 (liprin beta 2)
Synonyms: liprin beta 2, Cclp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 19024
HGNC: HGNC:9250
Homologene: 7486
Trrap
Name: transformation/transcription domain-associated protein
Synonyms: transactivation/transformation-domain associated protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 100683
Homologene: 39246
Ranbp2
Name: RAN binding protein 2
Synonyms: A430087B05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 19386
VEGA: 10
Homologene: 87808
Ddb1
Name: damage specific DNA binding protein 1
Synonyms: DNA repair protein, damage-specific DNA-binding protein, DNA repair, p127-Ddb1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 13194
VEGA: 19
HGNC: HGNC:2717
Homologene: 1448
C77080
Name: expressed sequence C77080
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 97130
Homologene: 45837
Tenm2
Name: teneurin transmembrane protein 2
Synonyms: D3Bwg1534e, 9330187F13Rik, Odz2, Ten-m2, 2610040L17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 23964
Homologene: 22672
Ptcd3
Name: pentatricopeptide repeat domain 3
Synonyms: 2810422B04Rik, 2610034F17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 69956
Homologene: 41211
Epg5
Name: ectopic P-granules autophagy protein 5 homolog (C. elegans)
Synonyms: 5430411K18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 100502841
VEGA: 18
Homologene: 14575
Zbtb14
Name: zinc finger and BTB domain containing 14
Synonyms: Zfp161, ZF5, b2b1982Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 22666
Homologene: 2560
Ap5z1
Name: adaptor-related protein complex 5, zeta 1 subunit
Synonyms: C330006K01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231855
Homologene: 18213
Kifc1
Name: kinesin family member C1
Synonyms: Tctex-7, Kifc5a, Tctex7a, Knsl2a, Gm4137, Tctex7, KNSL2, HSET, Tctex-7A, kinesin family c-terminal 5A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 100502766
HGNC: HGNC:6389
Homologene: 83229
Ripor2
Name: RHO family interacting cell polarization regulator 2
Synonyms: E430013J17Rik, Fam65b, 1700108N18Rik, 6330500D04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 193385
Homologene: 9284
Klhl8
Name: kelch-like 8
Synonyms: D5Ertd431e, 2310001P09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 246293
Homologene: 10819
Mlph
Name: melanophilin
Synonyms: D1Wsu84e, Slac-2a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 171531
Homologene: 11465
Fbn1
Name: fibrillin 1
Synonyms: Fib-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 14118
HGNC: HGNC:3603
Homologene: 30958
Fam184b
Name: family with sequence similarity 184, member B
Synonyms: 9630031F12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 58227
Homologene: 137353
Ccdc38
Name: coiled-coil domain containing 38
Synonyms: 4933417K05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 237465
Homologene: 52182
Neb
Name: nebulin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 17996
HGNC: HGNC:7720
Homologene: 136285
Dlgap2
Name: DLG associated protein 2
Synonyms: SAP90/PSD-95-associated protein 2, PSD-95/SAP90-binding protein 2, Sapap2, 6430596N04Rik, DAP2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 244310
HGNC: HGNC:2906
Homologene: 3484
Rims1
Name: regulating synaptic membrane exocytosis 1
Synonyms: RIM1alpha, C030033M19Rik, RIM1a, RIM1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 116837
Homologene: 128399
Oplah
Name: 5-oxoprolinase (ATP-hydrolysing)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 75475
HGNC: HGNC:8149
Homologene: 90938
Gpatch1
Name: G patch domain containing 1
Synonyms: 1300003A17Rik, Gpatc1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 67471
Homologene: 41217
Inpp4b
Name: inositol polyphosphate-4-phosphatase, type II
Synonyms: E130107I17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234515
HGNC: HGNC:6075
Homologene: 20832
Cps1
Name: carbamoyl-phosphate synthetase 1
Synonyms: D1Ucla3, CPSase I, 4732433M03Rik, CPS
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 227231
HGNC: HGNC:2323
Homologene: 68208
Meikin
Name: meiotic kinetochore factor
Synonyms: 4930404A10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 74847
Homologene: 54900
Polb
Name: polymerase (DNA directed), beta
Synonyms: A430088C08Rik, Pol beta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 18970
HGNC: HGNC:9174
Homologene: 2013
Vill
Name: villin-like
Synonyms: Villp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 22351
Homologene: 22650
Cyp2a4
Name: cytochrome P450, family 2, subfamily a, polypeptide 4
Synonyms: D7Ucla4, testosterone 15alpha-hydroxylase, Cyp15a1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 13086
Homologene: 85917
Obox1
Name: oocyte specific homeobox 1
Synonyms: 7420700M11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 71468
Homologene: 44937
Klhl30
Name: kelch-like 30
Synonyms: 4631423F02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 70788
Homologene: 18891
Nfxl1
Name: nuclear transcription factor, X-box binding-like 1
Synonyms: LOC381696, 1700012H24Rik, TCF9, D430033A06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 100978
Homologene: 26752
Cd47
Name: CD47 antigen (Rh-related antigen, integrin-associated signal transducer)
Synonyms: 9130415E20Rik, Itgp, B430305P08Rik, IAP, integrin-associated protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 16423
HGNC: HGNC:1682
Homologene: 1346
Zfp248
Name: zinc finger protein 248
Synonyms: E130106N01Rik, 2810037F07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 72720
Homologene: 69325
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 22,296,948 bp
  • T to C, chromosome 1 at 67,230,281 bp
  • T to A, chromosome 1 at 90,941,703 bp
  • C to T, chromosome 1 at 91,361,076 bp
  • T to C, chromosome 2 at 52,243,389 bp
  • T to A, chromosome 2 at 125,346,434 bp
  • A to G, chromosome 3 at 79,087,968 bp
  • T to A, chromosome 4 at 127,049,611 bp
  • A to G, chromosome 4 at 129,222,289 bp
  • T to C, chromosome 5 at 45,555,143 bp
  • G to A, chromosome 5 at 72,524,145 bp
  • A to C, chromosome 5 at 103,863,183 bp
  • G to A, chromosome 5 at 142,470,458 bp
  • A to G, chromosome 5 at 144,846,618 bp
  • C to A, chromosome 6 at 71,908,653 bp
  • A to G, chromosome 6 at 118,433,373 bp
  • A to T, chromosome 7 at 15,555,501 bp
  • A to G, chromosome 7 at 16,378,408 bp
  • A to G, chromosome 7 at 26,312,923 bp
  • A to T, chromosome 7 at 35,291,762 bp
  • A to G, chromosome 7 at 45,046,218 bp
  • A to G, chromosome 7 at 107,685,988 bp
  • T to C, chromosome 8 at 14,831,228 bp
  • T to C, chromosome 8 at 22,653,057 bp
  • T to G, chromosome 8 at 81,743,816 bp
  • ACTGCTGCTGCTGCTGC to ACTGCTGCTGCTGCTGCTGC, chromosome 9 at 65,651,666 bp
  • C to A, chromosome 9 at 119,061,494 bp
  • T to C, chromosome 10 at 58,485,893 bp
  • C to T, chromosome 10 at 93,582,434 bp
  • T to C, chromosome 11 at 36,008,454 bp
  • T to A, chromosome 11 at 54,398,444 bp
  • T to C, chromosome 13 at 24,673,112 bp
  • G to A, chromosome 15 at 76,306,555 bp
  • T to C, chromosome 16 at 49,894,180 bp
  • T to C, chromosome 17 at 33,883,875 bp
  • A to G, chromosome 17 at 69,387,580 bp
  • A to G, chromosome 18 at 77,981,326 bp
  • G to A, chromosome 19 at 10,608,318 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1374 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
039438-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.