Strain Name:
C57BL/6J-MtgxR1714Btlr/Mmmh
Stock Number:
039747-MU
Citation ID:
RRID:MMRRC_039747-MU
Other Names:
R1714 (G1), C57BL/6J-MtgxR1714Btlr
Major Collection:

Strain Information

Ppp5c
Name: protein phosphatase 5, catalytic subunit
Synonyms: ANP receptor, PP5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 19060
HGNC: HGNC:9322
Homologene: 4550
Kl
Name: klotho
Synonyms: alpha-kl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 16591
HGNC: HGNC:6344
Homologene: 68415
Rgs10
Name: regulator of G-protein signalling 10
Synonyms: 2310010N19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 67865
HGNC: HGNC:9992
Homologene: 37710
Cdc42se2
Name: CDC42 small effector 2
Synonyms: SPEC2, 2810404F18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 72729
Homologene: 41356
Rbpms2
Name: RNA binding protein with multiple splicing 2
Synonyms: 2400008B06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 71973
VEGA: 9
Homologene: 49895
Dock5
Name: dedicator of cytokinesis 5
Synonyms: lr2, 1110060D06Rik, rlc
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 68813
VEGA: 14
Homologene: 57016
Dmd
Name: dystrophin, muscular dystrophy
Synonyms: Duchenne muscular dystrophy, mdx, pke, X-linked muscular dystrophy, Dp427, Dp71, dys
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 13405
HGNC: HGNC:2928
Homologene: 20856
Mycbp2
Name: MYC binding protein 2, E3 ubiquitin protein ligase
Synonyms: Pam, C130061D10Rik, Phr1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 105689
Homologene: 9005
Usp46
Name: ubiquitin specific peptidase 46
Synonyms: 2410018I08Rik, 1190009E20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 69727
Homologene: 56957
Prrc2c
Name: proline-rich coiled-coil 2C
Synonyms: 9630039I18Rik, 1810043M20Rik, Bat2d, Bat2l2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226562
Homologene: 41015
Ptprg
Name: protein tyrosine phosphatase receptor type G
Synonyms: 5430405N12Rik, RPTPgamma
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 19270
HGNC: HGNC:9671
Homologene: 2129
Chd9
Name: chromodomain helicase DNA binding protein 9
Synonyms: 1810014J18Rik, AD013, A330063D19Rik, 9030205D12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 109151
Homologene: 11844
Ndufa9
Name: NADH:ubiquinone oxidoreductase subunit A9
Synonyms: 1010001N11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 66108
HGNC: HGNC:7693
Homologene: 3666
Zfp292
Name: zinc finger protein 292
Synonyms: Zn-16, Zn-15, Krox-10, Zfp-15, 9430062L07Rik, 5730450D02Rik, Zfp15
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 30046
Homologene: 8493
Dclk2
Name: doublecortin-like kinase 2
Synonyms: 6330415M09Rik, Click-II, Dcamkl2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 70762
Homologene: 69431
Ralgapa1
Name: Ral GTPase activating protein, alpha subunit 1
Synonyms: 4930400K19Rik, Tulip1, 2310003F20Rik, Garnl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 56784
VEGA: 12
Homologene: 84805
Traf3
Name: TNF receptor-associated factor 3
Synonyms: LAP1, CAP-1, CD40bp, CRAF1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 22031
Homologene: 7981
Letm1
Name: leucine zipper-EF-hand containing transmembrane protein 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 56384
HGNC: HGNC:6556
Homologene: 56320
Pus10
Name: pseudouridylate synthase 10
Synonyms: 2810013G11Rik, 4933435A13Rik, Ccdc139
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 74467
Homologene: 12566
Fan1
Name: FANCD2/FANCI-associated nuclease 1
Synonyms: 6030441H18Rik, Mtmr15
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 330554
Homologene: 45598
Fcrl5
Name: Fc receptor-like 5
Synonyms: BXMAS1-like protein 2, Fcrh3, mBXMH2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 329693
Homologene: 137404
Lnx1
Name: ligand of numb-protein X 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 16924
HGNC: HGNC:6657
Homologene: 7819
Zfp169
Name: zinc finger protein 169
Synonyms: 4930429A13Rik, 1700025J14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 67911
Homologene: 2572
Dynll2
Name: dynein light chain LC8-type 2
Synonyms: 1700064A15Rik, 6720463E02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 68097
Homologene: 115597
Arhgef3
Name: Rho guanine nucleotide exchange factor 3
Synonyms: 1200004I24Rik, C76747, 9830169H03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 71704
VEGA: 14
HGNC: HGNC:683
Homologene: 41329
Cxxc1
Name: CXXC finger protein 1
Synonyms: 5830420C16Rik, 2410002I16Rik, PHF18, Cgbp, Cfp1, CXXC finger 1 (PHD domain)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 74322
VEGA: 18
Homologene: 32221
Brd8
Name: bromodomain containing 8
Synonyms: p120, SMAP, 2610007E11Rik, 4432404P07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 78656
Homologene: 41790
Fbxo34
Name: F-box protein 34
Synonyms: 5830426G16Rik, 2900057B08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 78938
VEGA: 14
Homologene: 12713
Zfp979
Name: zinc finger protein 979
Synonyms: 2610305D13Rik, Ssm1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 112422
Homologene: 133076
Ddx11
Name: DEAD/H box helicase 11
Synonyms: KRG2, CHL1, 4732462I11Rik, CHLR1, essa15a, DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 320209
VEGA: 17
Homologene: 68973
Ssh2
Name: slingshot protein phosphatase 2
Synonyms: SSH-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 237860
Homologene: 14116
Haus3
Name: HAUS augmin-like complex, subunit 3
Synonyms: D4S43h, D5H4S43, D5H4S43E
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231123
Homologene: 75209
Lrrc8c
Name: leucine rich repeat containing 8 family, member C
Synonyms: E430036I04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 100604
Homologene: 12997
Cngb1
Name: cyclic nucleotide gated channel beta 1
Synonyms: Cngb1, Cngb1b, BC016201
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 333329
HGNC: HGNC:2151
Homologene: 136420
Csmd1
Name: CUB and Sushi multiple domains 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 94109
Homologene: 69536
Abca13
Name: ATP-binding cassette, sub-family A member 13
Synonyms: A930002G16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 268379
Homologene: 27991
Ercc5
Name: excision repair cross-complementing rodent repair deficiency, complementation group 5
Synonyms: Xpg
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 22592
HGNC: HGNC:3437
Homologene: 133551
Rsph1
Name: radial spoke head 1 homolog (Chlamydomonas)
Synonyms: meichroacidin, Tsga2, MCA
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 22092
VEGA: 17
Homologene: 11905
Il20ra
Name: interleukin 20 receptor, alpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 237313
VEGA: 10
HGNC: HGNC:6003
Homologene: 8685
Syne2
Name: spectrin repeat containing, nuclear envelope 2
Synonyms: nesprin-2, syne-2, D12Ertd777e, 6820443O06Rik, Nesp2g, Cpfl8, diminished cone electroretinogram, dice
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 319565
Homologene: 56700
Clk4
Name: CDC like kinase 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 12750
Homologene: 56895
Lamc3
Name: laminin gamma 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 23928
HGNC: HGNC:6494
Homologene: 21222
Myh11
Name: myosin, heavy polypeptide 11, smooth muscle
Synonyms: smMHC, SM2, SM1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 17880
VEGA: 16
HGNC: HGNC:7569
Homologene: 128512
AC225448.1
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Krt34
Name: keratin 34
Synonyms: 4733401E01Rik, Krt1-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 16672
HGNC: HGNC:6452
Homologene: 31083
Abcb11
Name: ATP-binding cassette, sub-family B member 11
Synonyms: PFIC2, ABC16, PGY4, Lith1, sister of P-glycoprotein, Bsep
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 27413
HGNC: HGNC:42
Homologene: 74509
Apba1
Name: amyloid beta precursor protein binding family A member 1
Synonyms: X11alpha, Lin-10, X11, Mint1, Mint, 6430513E09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 319924
VEGA: 19
HGNC: HGNC:578
Homologene: 897
H2bc1
Name: H2B clustered histone 1
Synonyms: Hist1h2ba
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 319177
Homologene: 69356
Rtn2
Name: reticulon 2 (Z-band associated protein)
Synonyms: Nspl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 20167
Homologene: 32180
Spag16
Name: sperm associated antigen 16
Synonyms: Pf20, 4930524F24Rik, 4930585K05Rik, Wdr29, 4921511D23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 66722
Homologene: 11572
Kmt2d
Name: lysine (K)-specific methyltransferase 2D
Synonyms: C430014K11Rik, Mll4, Mll2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 381022
HGNC: HGNC:7133
Homologene: 86893
Shbg
Name: sex hormone binding globulin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 20415
Homologene: 813
Dnai1
Name: dynein axonemal intermediate chain 1
Synonyms: 1110066F04Rik, Dnaic1, b2b1526Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 68922
HGNC: HGNC:2954
Homologene: 8122
Mpeg1
Name: macrophage expressed gene 1
Synonyms: Mpg-1, MPS1, Perforin-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 17476
VEGA: 19
Homologene: 11216
Kdr
Name: kinase insert domain protein receptor
Synonyms: VEGF receptor-2, VEGFR-2, vascular endothelial growth factor receptor- 2, VEGFR2, Flk-1, Flk1, orv
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 16542
HGNC: HGNC:6307
Homologene: 55639
Cfap57
Name: cilia and flagella associated protein 57
Synonyms: C130004B06Rik, LOC384050, 1110020C03Rik, Wdr65
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 68625
Homologene: 51350
2210408I21Rik
Name: RIKEN cDNA 2210408I21 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 72371
Homologene: 89234
Adgrg6
Name: adhesion G protein-coupled receptor G6
Synonyms: LOC215798, 1190004A11Rik, DREG, Gpr126
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 215798
Homologene: 10724
Aqp12
Name: aquaporin 12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 208760
Homologene: 45582
Rfpl4
Name: ret finger protein-like 4
Synonyms: D7Ertd486e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 192658
Homologene: 90101
Zfr2
Name: zinc finger RNA binding protein 2
Synonyms: 2010013I23Rik, 9130206N08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 103406
Homologene: 88124
Ankmy1
Name: ankyrin repeat and MYND domain containing 1
Synonyms: 4930483I10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 241158
Homologene: 9561
Ube2j1
Name: ubiquitin-conjugating enzyme E2J 1
Synonyms: 0710008M05Rik, Ncube, Ubc6p, 1110030I22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 56228
Homologene: 41090
Gabrb3
Name: GABRB3, gamma-aminobutyric acid type A receptor subunit beta 3
Synonyms: Gabrb-3, A230092K12Rik, beta3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 14402
HGNC: HGNC:4083
Homologene: 633
Kcnq3
Name: potassium voltage-gated channel, subfamily Q, member 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 110862
HGNC: HGNC:6297
Homologene: 20949
Zfp763
Name: zinc finger protein 763
Synonyms: 1700065O13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 73451
Homologene: 66274
Cr2
Name: complement receptor 2
Synonyms: CD21, CD35, Cr-1, Cr-2, Cr1, C3DR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12902
HGNC: HGNC:2336
Homologene: 55611
Sstr3
Name: somatostatin receptor 3
Synonyms: sst3, Smstr-3, Smstr3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 20607
VEGA: 15
Homologene: 20285
Vmn1r200
Name: vomeronasal 1 receptor 200
Synonyms: V1rh3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 171246
Homologene: 110880
Zfp827
Name: zinc finger protein 827
Synonyms: 2810449M09Rik, D630040G17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 622675
Homologene: 45622
Clca4c-ps
Name: chloride channel accessory 4C, pseudogene
Synonyms: Gm6289, Clca4c, Gm18718
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 622139
Or4e5
Name: olfactory receptor family 4 subfamily E member 5
Synonyms: GA_x6K02T2RJGY-491851-492792, MOR244-1, MOR28, Olfr1507
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 57269
HGNC: HGNC:8296
Homologene: 10736
Polr3d
Name: polymerase (RNA) III (DNA directed) polypeptide D
Synonyms: 2810426M17Rik, 44kDa, TSBN51, BN51T, RPC4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 67065
VEGA: 14
HGNC: HGNC:1080
Homologene: 1303
Or8s8
Name: olfactory receptor family 8 subfamily S member 8
Synonyms: GA_x6K02T2NBG7-5275017-5274082, MOR160-5, Olfr281
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 258277
Homologene: 133703
Isg15
Name: ISG15 ubiquitin-like modifier
Synonyms: G1p2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 100038882
VEGA: 4
HGNC: HGNC:4053
Homologene: 48326
Speer4f2
Name: spermatogenesis associated glutamate (E)-rich protein 4f2
Synonyms: Gm3535, Gm3495
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 100041749
Or4f4b
Name: olfactory receptor family 4 subfamily F member 4B
Synonyms: GA_x6K02T2Q125-72534883-72535821, MOR245-6, Olfr1289
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258399
HGNC: HGNC:8301
Klk1b24
Name: kallikrein 1-related peptidase b24
Synonyms: mGk-24, Klk24
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 16617
Homologene: 68141
Fndc4
Name: fibronectin type III domain containing 4
Synonyms: 6330410H20Rik, FRCP1, 2810430J06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 64339
Homologene: 49716
Dnajc5b
Name: DnaJ heat shock protein family (Hsp40) member C5 beta
Synonyms: 1700008A05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 66326
Homologene: 32634
Ydjc
Name: YdjC homolog (bacterial)
Synonyms: 4930521M19Rik, 1810015A11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 69101
Homologene: 19062
Sbk2
Name: SH3-binding domain kinase family, member 2
Synonyms: LOC381836
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 381836
Homologene: 30927
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 44,167,339 bp
  • A to G, chromosome 1 at 69,843,005 bp
  • G to T, chromosome 1 at 92,885,194 bp
  • T to A, chromosome 1 at 93,006,959 bp
  • G to A, chromosome 1 at 162,677,376 bp
  • A to T, chromosome 1 at 195,151,686 bp
  • A to G, chromosome 2 at 31,940,757 bp
  • A to C, chromosome 2 at 69,306,581 bp
  • A to T, chromosome 2 at 111,483,663 bp
  • A to T, chromosome 3 at 19,579,101 bp
  • G to A, chromosome 3 at 86,906,093 bp
  • T to A, chromosome 3 at 87,446,406 bp
  • T to A, chromosome 3 at 144,889,782 bp
  • A to G, chromosome 4 at 33,049,886 bp
  • A to G, chromosome 4 at 34,808,935 bp
  • T to C, chromosome 4 at 41,632,164 bp
  • A to C, chromosome 4 at 118,576,727 bp
  • A to T, chromosome 4 at 147,613,985 bp
  • A to T, chromosome 4 at 156,199,957 bp
  • T to C, chromosome 5 at 17,376,682 bp
  • A to G, chromosome 5 at 31,293,679 bp
  • G to T, chromosome 5 at 33,760,884 bp
  • A to T, chromosome 5 at 34,163,697 bp
  • A to G, chromosome 5 at 74,003,167 bp
  • C to T, chromosome 5 at 74,607,737 bp
  • A to T, chromosome 5 at 75,941,970 bp
  • A to G, chromosome 5 at 105,607,291 bp
  • A to T, chromosome 5 at 150,953,333 bp
  • T to C, chromosome 6 at 126,822,191 bp
  • T to C, chromosome 7 at 4,963,122 bp
  • T to G, chromosome 7 at 5,110,358 bp
  • T to C, chromosome 7 at 17,008,703 bp
  • C to T, chromosome 7 at 19,293,596 bp
  • C to A, chromosome 7 at 44,191,515 bp
  • A to T, chromosome 7 at 57,765,428 bp
  • T to C, chromosome 7 at 64,366,687 bp
  • A to G, chromosome 7 at 128,403,222 bp
  • G to A, chromosome 8 at 15,912,503 bp
  • A to T, chromosome 8 at 79,060,573 bp
  • A to C, chromosome 8 at 91,034,225 bp
  • A to G, chromosome 8 at 95,257,931 bp
  • CACT to CACTACT, chromosome 9 at 65,651,665 bp
  • ACTGCTGCTGCTGCTGC to ACTGCTGCTGCTGCTGCTGC, chromosome 9 at 65,651,666 bp
  • G to T, chromosome 10 at 14,439,770 bp
  • T to C, chromosome 10 at 19,755,828 bp
  • T to C, chromosome 10 at 81,244,749 bp
  • C to A, chromosome 11 at 9,483,804 bp
  • T to A, chromosome 11 at 23,725,542 bp
  • C to T, chromosome 11 at 51,280,418 bp
  • A to T, chromosome 11 at 54,740,286 bp
  • A to T, chromosome 11 at 69,617,157 bp
  • G to A, chromosome 11 at 77,454,024 bp
  • T to A, chromosome 11 at 87,984,012 bp
  • A to G, chromosome 11 at 100,040,127 bp
  • A to G, chromosome 12 at 55,642,389 bp
  • C to A, chromosome 12 at 76,054,939 bp
  • A to G, chromosome 12 at 111,242,473 bp
  • T to C, chromosome 13 at 22,395,470 bp
  • T to C, chromosome 13 at 23,933,952 bp
  • T to C, chromosome 13 at 48,498,854 bp
  • C to T, chromosome 13 at 77,316,360 bp
  • C to A, chromosome 14 at 12,213,697 bp
  • A to G, chromosome 14 at 27,397,744 bp
  • A to G, chromosome 14 at 47,529,201 bp
  • A to C, chromosome 14 at 52,490,414 bp
  • G to A, chromosome 14 at 67,812,252 bp
  • A to C, chromosome 14 at 70,441,315 bp
  • A to T, chromosome 14 at 103,138,708 bp
  • A to G, chromosome 15 at 66,000,063 bp
  • A to T, chromosome 15 at 78,540,273 bp
  • G to A, chromosome 15 at 98,456,733 bp
  • A to C, chromosome 15 at 98,862,950 bp
  • C to T, chromosome 16 at 14,236,368 bp
  • G to A, chromosome 16 at 17,147,799 bp
  • T to C, chromosome 17 at 31,255,216 bp
  • C to T, chromosome 17 at 33,019,617 bp
  • T to G, chromosome 17 at 66,148,759 bp
  • C to A, chromosome 17 at 94,875,806 bp
  • A to T, chromosome 18 at 34,609,833 bp
  • C to A, chromosome 18 at 74,219,863 bp
  • A to T, chromosome 19 at 12,462,834 bp
  • G to A, chromosome 19 at 23,944,952 bp
  • A to C, chromosome X at 83,964,750 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1714 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039747-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.