Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1714Btlr/Mmmh
Stock Number:
039747-MU
Citation ID:
RRID:MMRRC_039747-MU
Other Names:
R1714 (G1), C57BL/6J-MtgxR1714Btlr
Major Collection:

Strain Information

Ppp5c
Name: protein phosphatase 5, catalytic subunit
Synonyms: ANP receptor, PP5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19060
HGNC: HGNC:9322
Homologene: 4550
Kl
Name: klotho
Synonyms: alpha-kl
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 16591
HGNC: HGNC:6344
Homologene: 68415
Rgs10
Name: regulator of G-protein signalling 10
Synonyms: 2310010N19Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67865
HGNC: HGNC:9992
Homologene: 37710
Cdc42se2
Name: CDC42 small effector 2
Synonyms: SPEC2, 2810404F18Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72729
Homologene: 41356
Rbpms2
Name: RNA binding protein with multiple splicing 2
Synonyms: 2400008B06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71973
VEGA: 9
Homologene: 49895
Dock5
Name: dedicator of cytokinesis 5
Synonyms: lr2, 1110060D06Rik, rlc
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 68813
VEGA: 14
Homologene: 57016
Dmd
Name: dystrophin, muscular dystrophy
Synonyms: Duchenne muscular dystrophy, mdx, pke, X-linked muscular dystrophy, Dp427, Dp71, dys
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 13405
HGNC: HGNC:2928
Homologene: 20856
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 44,167,339 bp
  • A to G, chromosome 1 at 69,843,005 bp
  • G to T, chromosome 1 at 92,885,194 bp
  • T to A, chromosome 1 at 93,006,959 bp
  • G to A, chromosome 1 at 162,677,376 bp
  • A to T, chromosome 1 at 195,151,686 bp
  • A to G, chromosome 2 at 31,940,757 bp
  • A to C, chromosome 2 at 69,306,581 bp
  • A to T, chromosome 2 at 111,483,663 bp
  • A to T, chromosome 3 at 19,579,101 bp
  • G to A, chromosome 3 at 86,906,093 bp
  • T to A, chromosome 3 at 87,446,406 bp
  • T to A, chromosome 3 at 144,889,782 bp
  • A to G, chromosome 4 at 33,049,886 bp
  • A to G, chromosome 4 at 34,808,935 bp
  • T to C, chromosome 4 at 41,632,164 bp
  • A to C, chromosome 4 at 118,576,727 bp
  • A to T, chromosome 4 at 147,613,985 bp
  • A to T, chromosome 4 at 156,199,957 bp
  • T to C, chromosome 5 at 17,376,682 bp
  • A to G, chromosome 5 at 31,293,679 bp
  • G to T, chromosome 5 at 33,760,884 bp
  • A to T, chromosome 5 at 34,163,697 bp
  • A to G, chromosome 5 at 74,003,167 bp
  • C to T, chromosome 5 at 74,607,737 bp
  • A to T, chromosome 5 at 75,941,970 bp
  • A to G, chromosome 5 at 105,607,291 bp
  • A to T, chromosome 5 at 150,953,333 bp
  • T to C, chromosome 6 at 126,822,191 bp
  • T to C, chromosome 7 at 4,963,122 bp
  • T to G, chromosome 7 at 5,110,358 bp
  • T to C, chromosome 7 at 17,008,703 bp
  • C to T, chromosome 7 at 19,293,596 bp
  • C to A, chromosome 7 at 44,191,515 bp
  • A to T, chromosome 7 at 57,765,428 bp
  • T to C, chromosome 7 at 64,366,687 bp
  • A to G, chromosome 7 at 128,403,222 bp
  • G to A, chromosome 8 at 15,912,503 bp
  • A to T, chromosome 8 at 79,060,573 bp
  • A to C, chromosome 8 at 91,034,225 bp
  • A to G, chromosome 8 at 95,257,931 bp
  • CACT to CACTACT, chromosome 9 at 65,651,665 bp
  • ACTGCTGCTGCTGCTGC to ACTGCTGCTGCTGCTGCTGC, chromosome 9 at 65,651,666 bp
  • G to T, chromosome 10 at 14,439,770 bp
  • T to C, chromosome 10 at 19,755,828 bp
  • T to C, chromosome 10 at 81,244,749 bp
  • C to A, chromosome 11 at 9,483,804 bp
  • T to A, chromosome 11 at 23,725,542 bp
  • C to T, chromosome 11 at 51,280,418 bp
  • A to T, chromosome 11 at 54,740,286 bp
  • A to T, chromosome 11 at 69,617,157 bp
  • G to A, chromosome 11 at 77,454,024 bp
  • T to A, chromosome 11 at 87,984,012 bp
  • A to G, chromosome 11 at 100,040,127 bp
  • A to G, chromosome 12 at 55,642,389 bp
  • C to A, chromosome 12 at 76,054,939 bp
  • A to G, chromosome 12 at 111,242,473 bp
  • T to C, chromosome 13 at 22,395,470 bp
  • T to C, chromosome 13 at 23,933,952 bp
  • T to C, chromosome 13 at 48,498,854 bp
  • C to T, chromosome 13 at 77,316,360 bp
  • C to A, chromosome 14 at 12,213,697 bp
  • A to G, chromosome 14 at 27,397,744 bp
  • A to G, chromosome 14 at 47,529,201 bp
  • A to C, chromosome 14 at 52,490,414 bp
  • G to A, chromosome 14 at 67,812,252 bp
  • A to C, chromosome 14 at 70,441,315 bp
  • A to T, chromosome 14 at 103,138,708 bp
  • A to G, chromosome 15 at 66,000,063 bp
  • A to T, chromosome 15 at 78,540,273 bp
  • G to A, chromosome 15 at 98,456,733 bp
  • A to C, chromosome 15 at 98,862,950 bp
  • C to T, chromosome 16 at 14,236,368 bp
  • G to A, chromosome 16 at 17,147,799 bp
  • T to C, chromosome 17 at 31,255,216 bp
  • C to T, chromosome 17 at 33,019,617 bp
  • T to G, chromosome 17 at 66,148,759 bp
  • C to A, chromosome 17 at 94,875,806 bp
  • A to T, chromosome 18 at 34,609,833 bp
  • C to A, chromosome 18 at 74,219,863 bp
  • A to T, chromosome 19 at 12,462,834 bp
  • G to A, chromosome 19 at 23,944,952 bp
  • A to C, chromosome X at 83,964,750 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1714 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039747-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.