Strain Name:
C57BL/6J-MtgxR2303Btlr/Mmmh
Stock Number:
040302-MU
Citation ID:
RRID:MMRRC_040302-MU
Other Names:
R2303 (G1), C57BL/6J-MtgxR2303Btlr
Major Collection:

Gene Information

Fn1
Name: fibronectin 1
Synonyms: Fn-1, Fn
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 14268
HGNC: HGNC:3778
Homologene: 1533
Prnp
Name: prion protein
Synonyms: PrP, PrPC, Sinc, Prn-i, Prn-p, PrPSc, CD230
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 19122
HGNC: HGNC:9449
Homologene: 7904
Ncoa7
Name: nuclear receptor coactivator 7
Synonyms: 9030406N13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 211329
VEGA: 10
Homologene: 65245
Arid1a
Name: AT rich interactive domain 1A (SWI-like)
Synonyms: Osa1, 1110030E03Rik, Smarcf1, BAF250a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 93760
Homologene: 21216
Zcchc8
Name: zinc finger, CCHC domain containing 8
Synonyms: 5730565F05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 70650
Homologene: 32349
Cct8
Name: chaperonin containing Tcp1, subunit 8 (theta)
Synonyms: Cctq, Tcpq
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 12469
HGNC: HGNC:1623
Homologene: 4802
Rcan1
Name: regulator of calcineurin 1
Synonyms: MCIP1, 2410048A02Rik, ADAPT78, CSP1, Dscr1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 54720
VEGA: 16
HGNC: HGNC:3040
Homologene: 3251
Kank2
Name: KN motif and ankyrin repeat domains 2
Synonyms: Ankrd25
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235041
VEGA: 9
Homologene: 9163
Ash1l
Name: ASH1 like histone lysine methyltransferase
Synonyms: chromatin remodeling factor, 8030453L17Rik, E430018P19Rik, KMT2H
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 192195
Homologene: 10225
Pdik1l
Name: PDLIM1 interacting kinase 1 like
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230809
Homologene: 36977
Spg11
Name: SPG11, spatacsin vesicle trafficking associated
Synonyms: C530005A01Rik, 6030465E24Rik, spastic paraplegia 11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 214585
Homologene: 41614
Aars
Name: alanyl-tRNA synthetase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234734
HGNC: HGNC:20
Homologene: 1213
Setd1a
Name: SET domain containing 1A
Synonyms: KMT2F
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233904
Homologene: 52251
Ppp4r3b
Name: protein phosphatase 4 regulatory subunit 3B
Synonyms: Smek2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 104570
Homologene: 68886
Fbxo46
Name: F-box protein 46
Synonyms: 4932704E22Rik, 20D7-FC4, Fbxo34l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 243867
Homologene: 18467
Zfhx4
Name: zinc finger homeodomain 4
Synonyms: Zfh-4, C130041O22Rik, Zfh4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 80892
Homologene: 23477
Hmcn1
Name: hemicentin 1
Synonyms: LOC240793, EG545370
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 545370
Homologene: 23741
Trappc11
Name: trafficking protein particle complex 11
Synonyms: D030016E14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 320714
Homologene: 11076
Fbp2
Name: fructose bisphosphatase 2
Synonyms: FBPase muscle, Fbp-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 14120
VEGA: 13
HGNC: HGNC:3607
Homologene: 55784
Mfsd6
Name: major facilitator superfamily domain containing 6
Synonyms: 9630025I22Rik, MMR2, 2210010L05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 98682
Homologene: 9784
Abca9
Name: ATP-binding cassette, sub-family A (ABC1), member 9
Synonyms: D630040K07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 217262
HGNC: HGNC:39
Homologene: 33332
Kdm1b
Name: lysine (K)-specific demethylase 1B
Synonyms: 4632428N09Rik, Aof1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 218214
Homologene: 14695
Stab1
Name: stabilin 1
Synonyms: MS-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 192187
Homologene: 9035
Pcdh18
Name: protocadherin 18
Synonyms: PCDH68L
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 73173
Homologene: 10389
Vwde
Name: von Willebrand factor D and EGF domains
Synonyms: LOC232585
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232585
Homologene: 35456
Acan
Name: aggrecan
Synonyms: Cspg1, Agc1, b2b183Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 11595
HGNC: HGNC:319
Homologene: 137204
Kcnh8
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: Kv12.1, ELK1, C130090D05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 211468
Homologene: 14332
Ercc3
Name: excision repair cross-complementing rodent repair deficiency, complementation group 3
Synonyms: XPB
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 13872
HGNC: HGNC:3435
Homologene: 96
Slc40a1
Name: solute carrier family 40 (iron-regulated transporter), member 1
Synonyms: Ol5, ferroportin1, IREG1, FPN1, metal transporting protein 1, MTP1, Dusg, Slc11a3, Pcm
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 53945
Homologene: 40959
Gnrhr
Name: gonadotropin releasing hormone receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 14715
HGNC: HGNC:4421
Homologene: 350
Mgat5
Name: mannoside acetylglucosaminyltransferase 5
Synonyms: GlcNAc-TV, beta1,6N-acetylglucosaminyltransferase V, 5330407H02Rik, 4930471A21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 107895
HGNC: HGNC:7049
Homologene: 1808
Dagla
Name: diacylglycerol lipase, alpha
Synonyms: Nsddr
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 269060
HGNC: HGNC:1165
Homologene: 4468
Or6c2
Name: olfactory receptor family 6 subfamily C member 2
Synonyms: GA_x6K02T2PULF-11205096-11206034, MOR114-1, Olfr791
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 258932
Homologene: 71950
Pcdhb6
Name: protocadherin beta 6
Synonyms: Pcdhb5B, PcdhbF
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 93877
HGNC: HGNC:8690
Homologene: 62177
Sema3g
Name: sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 218877
Homologene: 10602
Slco5a1
Name: solute carrier organic anion transporter family, member 5A1
Synonyms: A630033C23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 240726
Homologene: 57135
4930583I09Rik
Name: RIKEN cDNA 4930583I09 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 78057
VEGA: 17
Gkn3
Name: gastrokine 3
Synonyms: 1190003M12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 68888
Homologene: 87422
Vmn2r-ps123
Name: vomeronasal 2, receptor, pseudogene 123
Synonyms: Gm4765
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 210465
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 12,879,262 bp
  • G to A, chromosome 1 at 45,910,884 bp
  • T to A, chromosome 1 at 52,676,513 bp
  • C to T, chromosome 1 at 71,614,036 bp
  • T to C, chromosome 1 at 127,446,299 bp
  • A to T, chromosome 1 at 150,704,226 bp
  • C to T, chromosome 2 at 122,068,837 bp
  • A to G, chromosome 2 at 131,937,126 bp
  • A to G, chromosome 3 at 5,397,060 bp
  • T to C, chromosome 3 at 49,755,274 bp
  • T to C, chromosome 3 at 89,026,426 bp
  • C to A, chromosome 4 at 133,687,251 bp
  • G to A, chromosome 4 at 134,284,248 bp
  • C to T, chromosome 5 at 86,197,749 bp
  • A to G, chromosome 5 at 123,700,597 bp
  • T to A, chromosome 6 at 13,215,807 bp
  • C to T, chromosome 6 at 87,383,525 bp
  • A to G, chromosome 7 at 19,136,616 bp
  • A to G, chromosome 7 at 79,099,957 bp
  • G to A, chromosome 7 at 127,799,155 bp
  • A to G, chromosome 8 at 47,503,416 bp
  • C to A, chromosome 8 at 111,052,502 bp
  • T to A, chromosome 9 at 21,769,765 bp
  • G to A, chromosome 10 at 30,654,435 bp
  • T to C, chromosome 10 at 129,527,049 bp
  • A to T, chromosome 11 at 29,200,741 bp
  • A to T, chromosome 11 at 110,158,226 bp
  • TCATTGTCC to TCATTGTCCATTGTCC, chromosome 13 at 47,064,088 bp
  • A to G, chromosome 13 at 62,837,291 bp
  • T to C, chromosome 14 at 31,146,070 bp
  • T to C, chromosome 14 at 31,222,615 bp
  • A to T, chromosome 16 at 87,490,332 bp
  • T to C, chromosome 16 at 92,393,596 bp
  • C to T, chromosome 17 at 19,857,519 bp
  • GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA, chromosome 17 at 52,725,906 bp
  • T to G, chromosome 17 at 64,834,566 bp
  • A to G, chromosome 18 at 32,245,547 bp
  • A to G, chromosome 18 at 37,336,231 bp
  • T to C, chromosome 19 at 10,252,103 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2303 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040302-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.