Strain Name:
C57BL/6J-MtgxR2844Btlr/Mmmh
Stock Number:
040437-MU
Citation ID:
RRID:MMRRC_040437-MU
Other Names:
R2844 (G1), C57BL/6J-MtgxR2844Btlr
Major Collection:

Strain Information

Ntrk2
Name: neurotrophic tyrosine kinase, receptor, type 2
Synonyms: trkB, Tkrb, C030027L06Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18212
VEGA: 13
HGNC: HGNC:8032
Homologene: 4504
Pnoc
Name: prepronociceptin
Synonyms: N23K, N/OFQ, Npnc1, OFQ/N, proorphanin
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 18155
VEGA: 14
HGNC: HGNC:9163
Homologene: 4537
Rfx3
Name: regulatory factor X, 3 (influences HLA class II expression)
Synonyms: C230093O12Rik, MRFX3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 19726
HGNC: HGNC:9984
Homologene: 7917
Ints6
Name: integrator complex subunit 6
Synonyms: DICE1, 2900075H24Rik, Ddx26, Notch2l
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 18130
VEGA: 14
Homologene: 8121
Fzr1
Name: fizzy and cell division cycle 20 related 1
Synonyms: Cdh1, Fyr
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 56371
Homologene: 9444
Plekha1
Name: pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1
Synonyms: TAPP1, C920009D07Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101476
Homologene: 11001
Rngtt
Name: RNA guanylyltransferase and 5'-phosphatase
Synonyms: mouse capping enzyme
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 24018
Homologene: 37851
Mark2
Name: MAP/microtubule affinity regulating kinase 2
Synonyms: Emk, Par-1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 13728
HGNC: HGNC:3332
Homologene: 69013
Psme4
Name: proteasome (prosome, macropain) activator subunit 4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103554
Homologene: 113742
Ttc17
Name: tetratricopeptide repeat domain 17
Synonyms: D2Bwg1005e, 9130020K17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74569
Homologene: 10100
Pi4ka
Name: phosphatidylinositol 4-kinase alpha
Synonyms: Pik4ca
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224020
HGNC: HGNC:8983
Homologene: 11171
Pex14
Name: peroxisomal biogenesis factor 14
Synonyms: Pex14p
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 56273
HGNC: HGNC:8856
Homologene: 37936
Fntb
Name: farnesyltransferase, CAAX box, beta
Synonyms: 2010013E13Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 110606
Homologene: 1535
Chd8
Name: chromodomain helicase DNA binding protein 8
Synonyms: Duplin, 5830451P18Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 67772
Homologene: 72405
Thbs1
Name: thrombospondin 1
Synonyms: TSP1, tbsp1, TSP-1, Thbs-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 21825
Homologene: 31142
Sbf1
Name: SET binding factor 1
Synonyms: B230113C15Rik, Mtmr5, 2610510A08Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 77980
Homologene: 84710
Zbtb8os
Name: zinc finger and BTB domain containing 8 opposite strand
Synonyms: 2310028N13Rik, Arch, 2010001H09Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67106
Homologene: 12083
Ccdc50
Name: coiled-coil domain containing 50
Synonyms: 5730448P06Rik, D16Bwg1543e, 2610529H08Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 67501
Homologene: 69406
Afg3l1
Name: AFG3-like AAA ATPase 1
Synonyms: 1700047G05Rik, 3110061K15Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 114896
HGNC: HGNC:314
Homologene: 134198
Gorab
Name: golgin, RAB6-interacting
Synonyms: Scyl1bp1, NTKL-BP1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98376
Homologene: 45113
Zfp648
Name: zinc finger protein 648
Synonyms: LOC207678, Gm10178
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 100503355
Homologene: 18996
Pde5a
Name: phosphodiesterase 5A, cGMP-specific
Synonyms: PDE5A1, Pde5
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242202
HGNC: HGNC:8784
Homologene: 842
Fhad1
Name: forkhead-associated phosphopeptide binding domain 1
Synonyms: 2900090M10Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329977
Homologene: 77947
Ciz1
Name: CDKN1A interacting zinc finger protein 1
Synonyms: 0610038H21Rik, 2900056O04Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68379
Homologene: 8112
Ccdc88b
Name: coiled-coil domain containing 88B
Synonyms: 2610041P08Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 78317
VEGA: 19
Homologene: 49992
Col19a1
Name: collagen, type XIX, alpha 1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12823
HGNC: HGNC:2196
Homologene: 55608
Dnaaf11
Name: dynein axonemal assembly factor 11
Synonyms: LRTP, Lrrc6
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 54562
Homologene: 34534
Aadacl2fm1
Name: AADACL2 family member 1
Synonyms: C130079G13Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229333
Sema5b
Name: sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B
Synonyms: SemG, SemG, Semag
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 20357
Homologene: 8427
Celsr3
Name: cadherin, EGF LAG seven-pass G-type receptor 3
Synonyms: Adgrc3, flamingo, Fmi1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 107934
HGNC: HGNC:3230
Homologene: 1077
Ppfia3
Name: protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3
Synonyms: 2410127E16Rik, Liprin-alpha3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76787
HGNC: HGNC:9247
Homologene: 37833
Gm11696
Name: predicted gene 11696
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 100036768
Med14
Name: mediator complex subunit 14
Synonyms: Crsp2, Trap170, LOC270579, 9930001L01Rik, ENSMUSG00000073278, ORF1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 26896
HGNC: HGNC:2370
Homologene: 22082
Ssh3
Name: slingshot protein phosphatase 3
Synonyms: SSH-3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 245857
VEGA: 19
Homologene: 32372
Abcb1a
Name: ATP-binding cassette, sub-family B member 1A
Synonyms: P-glycoprotein, mdr-3, Mdr1a, Pgy3, MDR3, Pgp, Pgy-3, Evi32, multiple drug resistant 1a, P-gp
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18671
HGNC: HGNC:40
Homologene: 55496
Tgfbr3l
Name: transforming growth factor, beta receptor III-like
Synonyms: Gm14378, LOC100039590
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 100044509
Homologene: 130375
Or1e25
Name: olfactory receptor family 1 subfamily E member 25
Synonyms: MOR135-5, GA_x6K02T2P1NL-3773152-3774090, Olfr384, GA_x6K02T2P1NL-3739520-3740032, Olfr386
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 193053
Homologene: 105206
Irx2
Name: Iroquois homeobox 2
Synonyms: IRX6
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 16372
Homologene: 56490
Zfp84
Name: zinc finger protein 84
Synonyms: C86188, 4633401C23Rik, 2210410P13Rik, Zfp69, KRAB18
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74352
Homologene: 51858
Ppil6
Name: peptidylprolyl isomerase (cyclophilin)-like 6
Synonyms: 2900084F20Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 73075
VEGA: 10
Homologene: 52155
Gm10608
Name: predicted gene 10608
Synonyms: EG546165
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 546165
VEGA: 9
Rnase11
Name: ribonuclease, RNase A family, 11 (non-active)
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 497113
Homologene: 17054
Atg4a
Name: autophagy related 4A, cysteine peptidase
Synonyms: autophagin 2, Apg4a, Autl2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 666468
Homologene: 70873
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 24,559,681 bp
  • A to T, chromosome 1 at 154,205,135 bp
  • A to G, chromosome 1 at 163,396,806 bp
  • T to C, chromosome 2 at 32,376,438 bp
  • A to T, chromosome 2 at 94,376,074 bp
  • C to T, chromosome 2 at 118,117,628 bp
  • G to A, chromosome 3 at 59,936,409 bp
  • T to C, chromosome 3 at 122,851,708 bp
  • A to G, chromosome 4 at 33,368,678 bp
  • A to T, chromosome 4 at 129,341,516 bp
  • G to T, chromosome 4 at 141,904,968 bp
  • A to T, chromosome 4 at 148,963,511 bp
  • A to T, chromosome 5 at 8,686,164 bp
  • T to G, chromosome 7 at 29,775,333 bp
  • C to A, chromosome 7 at 45,356,428 bp
  • G to T, chromosome 7 at 130,908,365 bp
  • A to G, chromosome 8 at 4,249,280 bp
  • T to C, chromosome 8 at 123,494,939 bp
  • G to T, chromosome 9 at 108,829,308 bp
  • CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA to CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA, chromosome 9 at 119,160,716 bp
  • A to T, chromosome 10 at 41,501,693 bp
  • G to T, chromosome 10 at 81,369,418 bp
  • T to C, chromosome 11 at 30,845,173 bp
  • A to T, chromosome 11 at 73,603,383 bp
  • T to C, chromosome 11 at 109,363,125 bp
  • C to A, chromosome 12 at 76,887,888 bp
  • C to T, chromosome 13 at 58,837,785 bp
  • A to G, chromosome 13 at 72,631,590 bp
  • A to G, chromosome 14 at 51,049,770 bp
  • C to T, chromosome 14 at 52,204,495 bp
  • A to G, chromosome 14 at 62,704,826 bp
  • A to T, chromosome 14 at 65,404,835 bp
  • A to G, chromosome 15 at 66,447,676 bp
  • A to G, chromosome 15 at 89,303,218 bp
  • T to C, chromosome 16 at 17,350,793 bp
  • A to G, chromosome 16 at 27,406,729 bp
  • A to G, chromosome 16 at 35,659,931 bp
  • T to C, chromosome 19 at 4,265,296 bp
  • T to G, chromosome 19 at 6,854,465 bp
  • T to C, chromosome 19 at 7,286,862 bp
  • T to C, chromosome 19 at 27,806,786 bp
  • A to T, chromosome X at 12,683,996 bp
  • G to A, chromosome X at 140,992,840 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2844 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040437-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.