Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR2884Btlr/Mmmh
Stock Number:
040472-MU
Citation ID:
RRID:MMRRC_040472-MU
Other Names:
R2884 (G1), C57BL/6J-MtgxR2884Btlr
Major Collection:

Strain Information

Utrn
Name: utrophin
Synonyms: G-utrophin, Dmdl, DRP
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22288
VEGA: 10
Homologene: 21398
Dnmt3a
Name: DNA methyltransferase 3A
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13435
HGNC: HGNC:2978
Homologene: 7294
H2-DMa
Name: histocompatibility 2, class II, locus DMa
Synonyms: H2-Ma, H-2Ma, H2-M alpha
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14998
HGNC: HGNC:4934
Homologene: 4464
Fam3c
Name: FAM3 metabolism regulating signaling molecule C
Synonyms: Fam3c, D6Wsu176e, Ilei
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 27999
Homologene: 8926
Nup93
Name: nucleoporin 93
Synonyms: 2410008G02Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 71805
Homologene: 40971
Setx
Name: senataxin
Synonyms: A930037J23Rik, Als4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269254
HGNC: HGNC:445
Homologene: 41003
Xrn2
Name: 5'-3' exoribonuclease 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 24128
Homologene: 6927
Grm7
Name: glutamate receptor, metabotropic 7
Synonyms: mGluR7, Gpr1g, E130018M02Rik, 6330570A01Rik, mGlu7a receptor
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 108073
HGNC: HGNC:4599
Homologene: 20233
Yju2
Name: YJU2 splicing factor
Synonyms: 2900016D05Rik, Ccdc94
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 72886
VEGA: 17
Homologene: 6350
Ppp4r3a
Name: protein phosphatase 4 regulatory subunit 3A
Synonyms: 1110034C04Rik, Smek1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 68734
VEGA: 12
Homologene: 69510
Naca
Name: nascent polypeptide-associated complex alpha polypeptide
Synonyms: skNAC, LOC380777
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17938
VEGA: 10
HGNC: HGNC:7629
Homologene: 136025
Gm7964
Name: predicted gene 7964
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 666170
Fcrl5
Name: Fc receptor-like 5
Synonyms: BXMAS1-like protein 2, Fcrh3, mBXMH2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329693
Homologene: 137404
Stau2
Name: staufen double-stranded RNA binding protein 2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 29819
Homologene: 8666
Znrf3
Name: zinc and ring finger 3
Synonyms: LOC382477
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 407821
Homologene: 46592
Amfr
Name: autocrine motility factor receptor
Synonyms: gp78
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 23802
HGNC: HGNC:463
Homologene: 888
Col1a2
Name: collagen, type I, alpha 2
Synonyms: Col1a-2, Cola2, Cola-2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12843
HGNC: HGNC:2198
Homologene: 69
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Cspg4b
Name: chondroitin sulfate proteoglycan 4B
Synonyms: BC067074
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 408066
Syne2
Name: spectrin repeat containing, nuclear envelope 2
Synonyms: nesprin-2, syne-2, D12Ertd777e, 6820443O06Rik, Nesp2g, Cpfl8, diminished cone electroretinogram, dice
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319565
Homologene: 56700
Myh13
Name: myosin, heavy polypeptide 13, skeletal muscle
Synonyms: extraocular myosin, EO Myosin, MyHC-eo
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 544791
HGNC: HGNC:7571
Homologene: 55780
Plekhs1
Name: pleckstrin homology domain containing, family S member 1
Synonyms: 9930023K05Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226245
VEGA: 19
Homologene: 11770
Rin2
Name: Ras and Rab interactor 2
Synonyms: RASSF4, 4632403N06Rik, 2010003K16Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74030
Homologene: 32430
Fras1
Name: Fraser extracellular matrix complex subunit 1
Synonyms: bl, E130113P14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231470
Homologene: 23516
Vmn2r88
Name: vomeronasal 2, receptor 88
Synonyms: V2r13, V2r3
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 669149
Homologene: 129606
Fam227b
Name: family with sequence similarity 227, member B
Synonyms: 4930525F21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75823
Homologene: 27384
Vmn2r82
Name: vomeronasal 2, receptor 82
Synonyms: EG624845
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 624845
Homologene: 83483
4732465J04Rik
Name: RIKEN cDNA 4732465J04 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 414105
Mdga2
Name: MAM domain containing glycosylphosphatidylinositol anchor 2
Synonyms: Mdga2, 9330209L04Rik, 6720489L24Rik, Mamdc1, Adp
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 320772
Homologene: 45659
Adck1
Name: aarF domain containing kinase 1
Synonyms: 2610005A10Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 72113
VEGA: 12
Homologene: 6493
Nprl3
Name: nitrogen permease regulator-like 3
Synonyms: -14 gene, m(alpha)RE, Prox1, HS-26, HS-40, Phg, Mare
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17168
Homologene: 8091
Mtnr1a
Name: melatonin receptor 1A
Synonyms: MelR, Mel1a receptor
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17773
HGNC: HGNC:7463
Homologene: 21207
Tpte
Name: transmembrane phosphatase with tensin homology
Synonyms: Pten2, Vsp
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234129
Homologene: 50411
Lilrb4a
Name: leukocyte immunoglobulin-like receptor, subfamily B, member 4A
Synonyms: CD85K, ILT3, HM18, Gp49b, Lilrb4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14728
VEGA: 10
HGNC: HGNC:6608
Homologene: 86756
Hexb
Name: hexosaminidase B
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 15212
VEGA: 13
HGNC: HGNC:4879
Homologene: 437
Ecd
Name: ecdysoneless cell cycle regulator
Synonyms: 5730461K03Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 70601
VEGA: 14
Homologene: 5256
Exoc3l4
Name: exocyst complex component 3-like 4
Synonyms: 1600013K19Rik, 1200009I06Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 74190
VEGA: 12
Homologene: 41760
Dnajb5
Name: DnaJ heat shock protein family (Hsp40) member B5
Synonyms: Hsp40-3, Hsc40, 1110058L06Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56323
Homologene: 8176
Prss48
Name: serine protease 48
Synonyms: Esspl, Gm1019
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 368202
Homologene: 133731
Naif1
Name: nuclear apoptosis inducing factor 1
Synonyms: 2310007O20Rik, 4933440H19Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71254
Homologene: 45669
Brsk1
Name: BR serine/threonine kinase 1
Synonyms: LOC381979, SAD-B
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381979
Homologene: 57169
Arhgap27
Name: Rho GTPase activating protein 27
Synonyms: 2310069I04Rik, 5730442P18Rik, Sh3d20
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 544817
Homologene: 45715
AC132379.1
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Or52b4
Name: olfactory receptor family 52 subfamily B member 4
Synonyms: GA_x6K02T2PBJ9-5256044-5256988, MOR31-4, Olfr547
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259083
Homologene: 17493
BC061237
Name: cDNA sequence BC061237
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 385138
Homologene: 128452
H2ac8
Name: H2A clustered histone 8
Synonyms: Hist1h2ae
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 319166
Homologene: 136768
Habp4
Name: hyaluronic acid binding protein 4
Synonyms: 4933413D03Rik, 4933428J01Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 56541
VEGA: 13
Homologene: 8615
Pth
Name: parathyroid hormone
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19226
HGNC: HGNC:9606
Homologene: 266
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 16,231,066 bp
  • T to A, chromosome 1 at 116,821,583 bp
  • T to G, chromosome 2 at 29,148,625 bp
  • C to T, chromosome 2 at 32,454,875 bp
  • G to T, chromosome 2 at 76,900,252 bp
  • A to T, chromosome 2 at 126,100,926 bp
  • A to T, chromosome 2 at 145,860,991 bp
  • T to A, chromosome 2 at 147,047,656 bp
  • A to T, chromosome 3 at 85,997,255 bp
  • A to G, chromosome 3 at 87,457,391 bp
  • A to T, chromosome 4 at 42,957,355 bp
  • A to G, chromosome 5 at 96,700,268 bp
  • G to A, chromosome 6 at 4,518,822 bp
  • G to A, chromosome 6 at 22,329,582 bp
  • G to T, chromosome 6 at 110,646,348 bp
  • A to G, chromosome 7 at 4,691,123 bp
  • A to T, chromosome 7 at 83,756,595 bp
  • A to G, chromosome 7 at 102,535,232 bp
  • A to T, chromosome 7 at 113,386,028 bp
  • C to T, chromosome 8 at 22,335,423 bp
  • A to G, chromosome 8 at 45,087,268 bp
  • C to T, chromosome 8 at 93,983,304 bp
  • A to G, chromosome 8 at 94,303,638 bp
  • G to T, chromosome 8 at 120,145,511 bp
  • A to T, chromosome 10 at 12,739,361 bp
  • A to T, chromosome 10 at 51,491,613 bp
  • A to G, chromosome 10 at 79,396,248 bp
  • GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT to GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT, chromosome 10 at 95,793,779 bp
  • T to C, chromosome 10 at 128,041,678 bp
  • A to T, chromosome 11 at 5,289,693 bp
  • A to G, chromosome 11 at 32,248,163 bp
  • T to A, chromosome 11 at 67,337,643 bp
  • T to C, chromosome 11 at 103,360,843 bp
  • A to G, chromosome 12 at 3,896,132 bp
  • A to G, chromosome 12 at 66,506,270 bp
  • T to G, chromosome 12 at 75,963,759 bp
  • G to T, chromosome 12 at 88,401,962 bp
  • T to C, chromosome 12 at 101,068,677 bp
  • A to G, chromosome 12 at 111,428,522 bp
  • A to G, chromosome 13 at 23,570,873 bp
  • A to T, chromosome 13 at 64,182,266 bp
  • C to T, chromosome 13 at 97,183,700 bp
  • G to T, chromosome 13 at 113,369,191 bp
  • C to T, chromosome 14 at 20,320,773 bp
  • A to G, chromosome 14 at 44,501,170 bp
  • G to A, chromosome 14 at 51,413,934 bp
  • A to G, chromosome 17 at 34,137,147 bp
  • T to A, chromosome 17 at 55,965,157 bp
  • G to A, chromosome 19 at 56,470,826 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2884 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040472-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.